ORK06641

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06641

Order Kazusa clone(s) from :

Accession No
Product ID	ORK06641
Clone name	bn03774
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	RFXANK
cDNA sequence	DNA sequence (1069 bp) Predicted protein sequence (284 aa)
HaloTag ORF Clone	FHC06641
Flexi ORF Clone	FXC06641
Description	regulatory factor X-associated ankyrin-containing protein

Features of the cloned cDNA sequence

Description

Length: 1069 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	149 bp
Genome contig ID	gi42406306f_19064778
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CCCAAGAGGAACCAATAAACCTTCTGTGCAGAATG
Flanking genome sequence (108901 - 108950)	----+--------+--------+--------+--------+----* AGGGACTTTGCTGTGCTTCCCGGAGGGCTTCCTGGAGGAGACAGCCCCTA

Features of the protein sequence

Description

Length: 284 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG73651	2.8e-96	100.0	regulatory fact...	synthetic construct
XP_512523	9.9e-96	99.6	regulatory fact...	Pan troglodytes
O14593	1.5e-95	99.6	DNA-binding pro...	Homo sapiens
CAG33262	2.7e-95	99.2	RFXANK [Homo sa...	Homo sapiens
XP_001115051	5.2e-94	98.0	similar to regu...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	148	160	PR01415	Ankyrin
FPrintScan	IPR002110	226	238	PR01415	Ankyrin
HMMPfam	IPR002110	147	179	PF00023	Ankyrin
	IPR002110	180	212	PF00023	Ankyrin
	IPR002110	213	245	PF00023	Ankyrin
	IPR002110	246	262	PF00023	Ankyrin
HMMSmart	IPR002110	147	176	SM00248	Ankyrin
	IPR002110	180	209	SM00248	Ankyrin
	IPR002110	213	242	SM00248	Ankyrin
	IPR002110	246	275	SM00248	Ankyrin
ProfileScan	IPR002110	113	266	PS50297	Ankyrin
	IPR002110	147	179	PS50088	Ankyrin
	IPR002110	180	212	PS50088	Ankyrin
	IPR002110	213	245	PS50088	Ankyrin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp