Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06660
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209099
Product ID ORK06660
Clone name hh03719
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol RLF
cDNA sequence DNA sequence (5983 bp)
Predicted protein sequence (1608 aa)
Description Zinc finger protein Rlf (Rearranged L-myc fusion gene protein) (Zn-15- related protein).
Features of the cloned cDNA sequence

Length: 5983 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 473 bp
Genome contig ID gi89161185f_40369063
PolyA signal sequence
(AATAAA,-22)		 
+----*----+----*----+----*----+----
TGAGTTGAGTTTCAATAAATTACAATTTTTCACCC
Flanking genome sequence
(110118 - 110167)		 
----+----*----+----*----+----*----+----*----+----*
ATTCGTTGTTTACTCATAATGAGCTTTCATGCCACATGTAAACTGAAATT

Features of the protein sequence

Length: 1608 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92336 0 100.0 rearranged L-my...
 Homo sapiens
Q13129 0 100.0 Zinc finger pro...
 Homo sapiens
XP_524678 0 99.8 rearranged L-my...
 Pan troglodytes
AAC50396 0 99.8 RLF [Homo sapiens].
 Homo sapiens
CAH90493 0 99.0 hypothetical pr...
 Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007087 365 390 PF00096 Zinc finger
IPR007087 465 489 PF00096 Zinc finger
IPR007087 495 519 PF00096 Zinc finger
IPR007087 648 673 PF00096 Zinc finger
IPR007087 821 846 PF00096 Zinc finger
IPR007087 866 889 PF00096 Zinc finger
HMMSmart IPR015880 249 270 SM00355 Zinc finger
IPR015880 276 298 SM00355 Zinc finger
IPR015880 365 390 SM00355 Zinc finger
IPR015880 408 430 SM00355 Zinc finger
IPR015880 436 460 SM00355 Zinc finger
IPR015880 465 489 SM00355 Zinc finger
IPR015880 495 519 SM00355 Zinc finger
IPR015880 648 673 SM00355 Zinc finger
IPR015880 821 846 SM00355 Zinc finger
IPR015880 866 889 SM00355 Zinc finger
IPR015880 1004 1029 SM00355 Zinc finger
IPR015880 1056 1081 SM00355 Zinc finger
IPR015880 1101 1126 SM00355 Zinc finger
IPR015880 1138 1163 SM00355 Zinc finger
IPR015880 1243 1268 SM00355 Zinc finger
ProfileScan IPR007087 276 303 PS50157 Zinc finger
IPR007087 365 395 PS50157 Zinc finger
IPR007087 408 435 PS50157 Zinc finger
IPR007087 436 465 PS50157 Zinc finger
IPR007087 465 494 PS50157 Zinc finger
IPR007087 495 524 PS50157 Zinc finger
IPR007087 648 673 PS50157 Zinc finger
IPR007087 866 889 PS50157 Zinc finger
IPR007087 1004 1034 PS50157 Zinc finger
IPR007087 1056 1086 PS50157 Zinc finger
IPR007087 1101 1131 PS50157 Zinc finger
ScanRegExp IPR007087 278 298 PS00028 Zinc finger
IPR007087 367 390 PS00028 Zinc finger
IPR007087 410 430 PS00028 Zinc finger
IPR007087 438 460 PS00028 Zinc finger
IPR007087 467 489 PS00028 Zinc finger
IPR007087 497 519 PS00028 Zinc finger
IPR007087 650 673 PS00028 Zinc finger
IPR007087 823 846 PS00028 Zinc finger
IPR007087 868 889 PS00028 Zinc finger
IPR007087 1006 1029 PS00028 Zinc finger
IPR007087 1058 1081 PS00028 Zinc finger
IPR007087 1103 1126 PS00028 Zinc finger
IPR007087 1140 1163 PS00028 Zinc finger
IPR007087 1245 1268 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp