ORK06674

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06674

Order Kazusa clone(s) from :

Accession No	AB209154
Product ID	ORK06674
Clone name	aj00414
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ROR2
cDNA sequence	DNA sequence (4356 bp) Predicted protein sequence (919 aa)
Description	Tyrosine-protein kinase transmembrane receptor ROR2 precursor (EC 2.7.10.1) (Neurotrophic tyrosine kinase, receptor-related 2).

Features of the cloned cDNA sequence

Description

Length: 4356 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1056 bp
Genome contig ID	gi89161216r_93424705
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CCACACCCGGTGTATCCAATAAAGTGAAACAAAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTGATTGGCTCTCTTGCAGGTTGTAAGGATGCGAGGCAGCGGGAGGCA

Features of the protein sequence

Description

Length: 919 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92391	100.0	Tyrosine-protei...	Homo sapiens
AAI30523	100.0	Receptor tyrosi...	Homo sapiens
AAA60276	99.8	transmembrane r...	Homo sapiens
Q01974	99.7	Tyrosine-protei...	Homo sapiens
AAG01184	99.8	ROR2 protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000001	295	371	PD000395	Kringle
BlastProDom	IPR000719	455	719	PD000001	Protein kinase
FPrintScan	IPR000001	292	307	PR00018	Kringle
	IPR000001	308	320	PR00018	Kringle
	IPR000001	334	354	PR00018	Kringle
	IPR000001	359	370	PR00018	Kringle
	IPR001245	529	542	PR00109	Tyrosine protein kinase
	IPR001245	581	599	PR00109	Tyrosine protein kinase
	IPR001245	630	640	PR00109	Tyrosine protein kinase
	IPR001245	649	671	PR00109	Tyrosine protein kinase
	IPR001245	693	715	PR00109	Tyrosine protein kinase
HMMPfam	IPR013098	38	128	PF07679	Immunoglobulin I-set
	IPR000024	144	277	PF01392	Frizzled CRD region
	IPR000001	292	370	PF00051	Kringle
	IPR001245	449	722	PF07714	Tyrosine protein kinase
HMMSmart	IPR003599	44	129	SM00409	Immunoglobulin subtype
	IPR003598	50	118	SM00408	Immunoglobulin subtype 2
	IPR000001	290	372	SM00130	Kringle
	IPR001245	449	722	SM00219	Tyrosine protein kinase
	IPR002290	449	726	SM00220	Serine/threonine protein kinase
ProfileScan	IPR007110	31	121	PS50835	Immunoglobulin-like
	IPR000024	145	279	PS50038	Frizzled CRD region
	IPR000001	291	370	PS50070	Kringle
	IPR000719	449	722	PS50011	Protein kinase
ScanRegExp	IPR000001	340	353	PS00021	Kringle
ScanRegExp	IPR008266	587	599	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	380	ILYILVPSIAIPLVIACLFFLVC	402	PRIMARY	23