Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06783
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209826
Product ID ORK06783
Clone name bm04918
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SERPING1
cDNA sequence DNA sequence (1816 bp)
Predicted protein sequence (515 aa)
Description Plasma protease C1 inhibitor precursor (C1 Inh) (C1Inh) (C1 esterase inhibitor) (C1-inhibiting factor).
Features of the cloned cDNA sequence

Length: 1816 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 266 bp
Genome contig ID gi51511727f_57023927
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CACCAGACTCTATAAATAAAACCTGACAGACCATG
Flanking genome sequence
(114971 - 115020)
----+----*----+----*----+----*----+----*----+----*
ACTTTCTCTGCTTTGCCTTTGTTTTTTTATTTTTTATTTTTTATTTTTTT

Features of the protein sequence

Length: 515 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93063 1.3e-179 100.0 Plasma protease...
Homo sapiens
AAH11171 2.1e-174 100.0 Serpin peptidas...
Homo sapiens
AAP36375 2.1e-174 100.0 serine (or cyst...
synthetic construct
P05155 4.6e-174 99.8 Plasma protease...
Homo sapiens
AAA35613 6.8e-174 99.6 plasma protease...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000215 150 513 PF00079 Protease inhibitor I4
HMMSmart IPR000215 166 513 SM00093 Protease inhibitor I4
ScanRegExp IPR000215 486 496 PS00284 Protease inhibitor I4
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp