ORK06802

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06802

Order Kazusa clone(s) from :

Accession No	AB209804
Product ID	ORK06802
Clone name	bm03625
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	SRSF5
cDNA sequence	DNA sequence (2681 bp) Predicted protein sequence (199 aa)
Description	Splicing factor, arginine/serine-rich 5 (Pre-mRNA-splicing factor SRP40) (Delayed-early protein HRS).

Features of the cloned cDNA sequence

Description

Length: 2681 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	544 bp
Genome contig ID	gi51511730f_69203642
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GCTGTTTGTTATTGATAATAAAATATTATAAAACT
Flanking genome sequence (104834 - 104883)	----+--------+--------+--------+--------+----* ACTTTTTGTCTGTTTGTCTGAAGAAGTCCTATGCTGATTATTTCTCATCC

Features of the protein sequence

Description

Length: 199 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93041	1.6e-64	100.0	CS0DF038YO05 va...	Homo sapiens
BAE90045	2.5e-55	99.4	unnamed protein...	Macaca fascicularis
XP_001144006	8.8e-45	99.3	similar to SRp4...	Pan troglodytes
Q13243	9.6e-45	99.3	Splicing factor...	Homo sapiens
AAP36166	9.6e-45	99.3	splicing factor...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	49	103	PF00076	RNA recognition motif

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	13	CTLSNIFSFSSLVFFISCDCLCV	35	PRIMARY	23