ORK06813

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06813

Order Kazusa clone(s) from :

Accession No	AB208911
Product ID	ORK06813
Clone name	sj04913
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SH2B3
cDNA sequence	DNA sequence (4642 bp) Predicted protein sequence (439 aa)
Description	SH2B adapter protein 3 (Lymphocyte-specific adapter protein Lnk) (Signal transduction protein Lnk) (Lymphocyte adapter protein).

Features of the cloned cDNA sequence

Description

Length: 4642 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3321 bp
Genome contig ID	gi89161190f_110240740
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TGCTATATGTGAATTAAAAAGTTTTCAGAATCTTG
Flanking genome sequence (133071 - 133120)	----+--------+--------+--------+--------+----* ATTTGCTGTCATAATATTTAAAGGCTCTATTAAGACCATGGTGTCTCTAC

Features of the protein sequence

Description

Length: 439 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92148	2.6e-171	100.0	lymphocyte adap...	Homo sapiens
EAW97956	1.2e-170	99.7	lymphocyte adap...	Homo sapiens
Q9UQQ2	1.2e-170	99.7	SH2B adapter pr...	Homo sapiens
CAB42642	3.2e-169	99.3	lymphocyte adap...	Homo sapiens
XP_001145612	2.9e-168	98.6	lymphocyte adap...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000980	228	315	PD000093	SH2 motif
FPrintScan	IPR000980	228	242	PR00401	SH2 motif
	IPR000980	250	260	PR00401	SH2 motif
	IPR000980	262	273	PR00401	SH2 motif
	IPR000980	294	308	PR00401	SH2 motif
HMMPfam	IPR001849	58	171	PF00169	Pleckstrin-like
HMMPfam	IPR000980	228	305	PF00017	SH2 motif
HMMSmart	IPR001849	59	173	SM00233	Pleckstrin-like
HMMSmart	IPR000980	226	311	SM00252	SH2 motif
ProfileScan	IPR000980	228	326	PS50001	SH2 motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp