Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06867
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209112
Product ID ORK06867
Clone name hh10138
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SLC2A8
cDNA sequence DNA sequence (5781 bp)
Predicted protein sequence (223 aa)
Description Solute carrier family 2, facilitated glucose transporter member 8 (Glucose transporter type 8) (GLUT-8) (Glucose transporter type X1).
Features of the cloned cDNA sequence

Length: 5781 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 4131 bp
Genome contig ID gi89161216f_129104644
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGGGAGACAGAACAAGACCCCAACCCCACCCCCGC
Flanking genome sequence None

Features of the protein sequence

Length: 223 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92349 4.5e-98 100.0 solute carrier ...
Homo sapiens
AAL55771 1.7e-12 91.0 unknown [Homo s...
Homo sapiens
CAH72916 1.7e-12 91.0 solute carrier ...
Homo sapiens
CAH72923 1.8e-12 91.0 solute carrier ...
Homo sapiens
CAH72921 1.8e-12 91.0 solute carrier ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR005828 52 91 PF00083 General substrate transporter
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp