ORK06900

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06900

Order Kazusa clone(s) from :

Accession No	AB209313
Product ID	ORK06900
Clone name	fh02848
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fh02848 has an irregular adapter sequence (GTCGACCCAC GCGTCCGA) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	SMARCA4
cDNA sequence	DNA sequence (5193 bp) Predicted protein sequence (1165 aa)
Description	Probable global transcription activator

Features of the cloned cDNA sequence

Description

Length: 5193 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1695 bp
Genome contig ID	gi42406306f_10855954
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCGACAGAGCGAGACTTTGTCTC
Flanking genome sequence (148390 - 148439)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGAAAAAAAGCCCATCCACGGCACCTGCATTGTTGG

Features of the protein sequence

Description

Length: 1165 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92550	100.0	SWI/SNF-related...	Homo sapiens
ACA09750	100.0	SMARCA4 isoform...	Homo sapiens
EAW84167	100.0	SWI/SNF related...	Homo sapiens
ACA09752	100.0	SMARCA4 isoform...	Homo sapiens
ACA09751	100.0	SMARCA4 isoform...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014978	128	164	PF08880	QLQ
	IPR006562	418	490	PF07529	HSA
	IPR006576	570	614	PF07533	BRK
	IPR000330	715	1010	PF00176	SNF2-related
	IPR001650	1073	1140	PF00271	DNA/RNA helicase
HMMSmart	IPR013999	418	490	SM00573	HAS subgroup
	IPR006576	570	614	SM00592	BRK
	IPR014001	708	900	SM00487	DEAD-like helicases
	IPR001650	1068	1151	SM00490	DNA/RNA helicase
ProfileScan	IPR014012	418	490	PS51204	Helicase/SANT-associated
	IPR014021	724	889	PS51192	Helicase
	IPR001650	1042	1165	PS51194	DNA/RNA helicase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp