Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06915
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209029
Product ID ORK06915
Clone name hh00902
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SNCB
cDNA sequence DNA sequence (5714 bp)
Predicted protein sequence (104 aa)
Description Beta-synuclein.
Features of the cloned cDNA sequence

Length: 5714 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3678 bp
Genome contig ID gi51511721r_175877438
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GAGCAAGACTCCGTCTAAAAAAAAAAAAGAAGAAG
Flanking genome sequence
(99513 - 99464)
----+----*----+----*----+----*----+----*----+----*
AAAGAAAGAAAAGAAGGCTGTCAGGTCAGTTGTCTGAGTTGTCTGAGGAG

Features of the protein sequence

Length: 104 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92266 5.2e-42 100.0 beta-synuclein ...
Homo sapiens
XP_001136653 8.8e-07 47.3 similar to Synu...
Pan troglodytes
XP_001136812 1.8e-06 48.0 beta-synuclein ...
Pan troglodytes
XP_001085146 1.9e-06 86.1 synuclein, beta...
Macaca mulatta
AAV67348 2.1e-06 86.1 synuclein beta ...
Macaca fascicularis
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002461 38 53 PR01213 Beta-synuclein
IPR002461 53 66 PR01213 Beta-synuclein
IPR002461 66 79 PR01213 Beta-synuclein
HMMPfam IPR001058 46 78 PF01387 Synuclein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp