Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06929
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226097
Product ID ORK06929
Clone name hh12035
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SNX14
cDNA sequence DNA sequence (1751 bp)
Predicted protein sequence (502 aa)
Description Sorting nexin-14.
Features of the cloned cDNA sequence

Length: 1751 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 161 bp
Genome contig ID gi89161210r_86172243
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
TGTTTTTAATAAAGACTAACACAAACTTAATGATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAGTGATTGAGTCTCATAGTCTTTCATTTGCTAGCTGTGATCCAAATT

Features of the protein sequence

Length: 502 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001152071 6.5e-208 99.8 sorting nexin 1...
Pan troglodytes
EAW48632 6.5e-208 99.8 sorting nexin 1...
Homo sapiens
EAW48631 7.1e-208 99.8 sorting nexin 1...
Homo sapiens
XP_001152374 7.1e-208 99.8 sorting nexin 1...
Pan troglodytes
CAI20445 7.4e-208 99.8 sorting nexin 1...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001683 133 242 PF00787 Phox-like
IPR013937 363 468 PF08628 Sorting nexin
HMMSmart IPR001683 123 242 SM00312 Phox-like
ProfileScan IPR001683 126 246 PS50195 Phox-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp