ORK06952

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06952

Order Kazusa clone(s) from :

Accession No	AB209334
Product ID	ORK06952
Clone name	fh11572
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SP3
cDNA sequence	DNA sequence (5472 bp) Predicted protein sequence (662 aa)
Description	Transcription factor Sp3 (SPR-2).

Features of the cloned cDNA sequence

Description

Length: 5472 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3482 bp
Genome contig ID	gi89161199r_174379434
PolyA signal sequence (ACTAAA,-23)	+--------+--------+----*----+---- GAATTATTTTTCACTAAACAGTATGTTTAAAACTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTGCCATGAATGAGTACTAAGTCTTTTGTTGTCTGACAATAAGCACAAA

Features of the protein sequence

Description

Length: 662 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92571	100.0	Sp3 transcripti...	Homo sapiens
AAA36630	99.6	Sp3 protein [Ho...	Homo sapiens
NP_001017371	99.6	transcription f...	Homo sapiens
Q02447	99.6	Transcription f...	Homo sapiens
XP_515917	99.5	Sp3 transcripti...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	532	557	PD000003	Zinc finger
BlastProDom	IPR007087	562	584	PD000003	Zinc finger
HMMPfam	IPR007087	532	556	PF00096	Zinc finger
HMMPfam	IPR007087	562	584	PF00096	Zinc finger
HMMSmart	IPR015880	502	526	SM00355	Zinc finger
	IPR015880	532	556	SM00355	Zinc finger
	IPR015880	562	584	SM00355	Zinc finger
ProfileScan	IPR007087	502	531	PS50157	Zinc finger
	IPR007087	532	561	PS50157	Zinc finger
	IPR007087	562	589	PS50157	Zinc finger
ScanRegExp	IPR007087	534	556	PS00028	Zinc finger
ScanRegExp	IPR007087	564	584	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp