ORK07011

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07011

Order Kazusa clone(s) from :

Accession No	AB209315
Product ID	ORK07011
Clone name	fh03862
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	STK4
cDNA sequence	DNA sequence (5085 bp) Predicted protein sequence (511 aa)
Description	Serine/threonine-protein kinase 4 (EC 2.7.11.1) (STE20-like kinase MST1) (MST-1) (Mammalian STE20-like protein kinase 1) (Serine/threonine-protein kinase Krs-2).

Features of the cloned cDNA sequence

Description

Length: 5085 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3549 bp
Genome contig ID	gi51511747f_42928550
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- TTTTAAATAAACTGTCCTTTGGACCACAAACCCTT
Flanking genome sequence (213465 - 213514)	----+--------+--------+--------+--------+----* ATTAACGAGAACCTCAATATATAGCCTGGATAATGGTGTTGTGAACAATC

Features of the protein sequence

Description

Length: 511 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92552	2.8e-192	100.0	serine/threonin...	Homo sapiens
Q13043	3.1e-180	99.5	Serine/threonin...	Homo sapiens
AAA83254	8e-180	99.5	MST1 [Homo sapi...	Homo sapiens
A4K2Y1	1.1e-179	99.1	Serine/threonin...	Chlorocebus aet...
A4K2P5	1.2e-179	98.9	Serine/threonin...	Colobus guereza

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	54	112	PD000001	Protein kinase
BlastProDom	IPR000719	119	304	PD000001	Protein kinase
HMMPfam	IPR000719	54	305	PF00069	Protein kinase
HMMSmart	IPR001245	54	305	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	54	305	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	54	305	PS50011	Protein kinase
ProfileScan	IPR011524	457	504	PS50951	SARAH
ScanRegExp	IPR000719	60	83	PS00107	Protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp