ORK07020

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07020

Order Kazusa clone(s) from :

Accession No	AB209296
Product ID	ORK07020
Clone name	fk07313
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	STX16
cDNA sequence	DNA sequence (3433 bp) Predicted protein sequence (383 aa)
Description	Syntaxin-16 (Syn16).

Features of the cloned cDNA sequence

Description

Length: 3433 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1711 bp
Genome contig ID	gi51511747f_56559896
PolyA signal sequence (None)	+--------+--------+----*----+---- CTGATTAATTTTAAGCAATTGAAAGATTGCCCTTC
Flanking genome sequence (163979 - 164028)	----+--------+--------+--------+--------+----* ATATGGGTTTTGGTTTGTCTTTCTGGTCGTCAGCGTGGTGGTGGAAACAG

Features of the protein sequence

Description

Length: 383 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92533	3.2e-152	100.0	syntaxin 16 iso...	Homo sapiens
O14662	6.6e-112	100.0	Syntaxin-16; Sh...	Homo sapiens
CAH89898	8.2e-111	99.3	hypothetical pr...	Pongo abelii
AAH73876	3.8e-109	98.6	STX16 protein [...	Homo sapiens
XP_001084615	5e-107	96.9	similar to synt...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006011	75	181	PF00804	Syntaxin
HMMPfam	IPR000727	236	298	PF05739	Target SNARE coiled-coil region
HMMSmart	IPR000727	226	293	SM00397	Target SNARE coiled-coil region
ProfileScan	IPR000727	231	293	PS50192	Target SNARE coiled-coil region
ScanRegExp	IPR006012	237	276	PS00914	Syntaxin/epimorphin coiled-coil

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp