ORK07035

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07035

Order Kazusa clone(s) from :

Accession No	AB209088
Product ID	ORK07035
Clone name	hk09858
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SYN2
cDNA sequence	DNA sequence (3835 bp) Predicted protein sequence (514 aa)
Description	Synapsin-2 (Synapsin II).

Features of the cloned cDNA sequence

Description

Length: 3835 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2288 bp
Genome contig ID	gi89161205f_11920880
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GCTTAATGTGCAATAAAGGAAAAGTTATATCTGTC
Flanking genome sequence (281350 - 281399)	----+--------+--------+--------+--------+----* TTCAGTGTTAAGTTGTAACGTTTCTGGCTATCCAAGTATCTGCACAAATG

Features of the protein sequence

Description

Length: 514 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92325	1.2e-146	100.0	synapsin II iso...	Homo sapiens
NP_003169	1.1e-120	97.4	synapsin-2 isof...	Homo sapiens
AAC33789	1.6e-120	97.2	synapsin IIb [H...	Homo sapiens
AAC50718	3.3e-120	97.2	synapsin IIb [H...	Homo sapiens
XP_001171832	8.2e-119	96.8	synapsin II [Pa...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001359	161	170	PR01368	Synapsin
	IPR001359	176	188	PR01368	Synapsin
	IPR001359	212	223	PR01368	Synapsin
	IPR001359	352	364	PR01368	Synapsin
	IPR001359	366	382	PR01368	Synapsin
	IPR001359	385	406	PR01368	Synapsin
HMMPfam	IPR001359	144	248	PF02078	Synapsin
HMMPfam	IPR001359	250	452	PF02750	Synapsin
ScanRegExp	IPR001359	53	60	PS00415	Synapsin
ScanRegExp	IPR001359	307	317	PS00416	Synapsin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp