ORK07056

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07056

Order Kazusa clone(s) from :

Accession No	AB209555
Product ID	ORK07056
Clone name	fk13135
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TAGLN
cDNA sequence	DNA sequence (3298 bp) Predicted protein sequence (112 aa)
Description	Transgelin (Smooth muscle protein 22-alpha) (SM22-alpha) (WS3-10) (22 kDa actin-binding protein).

Features of the cloned cDNA sequence

Description

Length: 3298 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	818 bp
Genome contig ID	gi51511727f_116477092
PolyA signal sequence (None)	+--------+--------+----*----+---- TATCTTGTCCTGGAATATTTTTGGGGTTGGAACTC
Flanking genome sequence (103596 - 103645)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAATCAATCTTTTCTCAGGCCTGGCTGGCAGAGTT

Features of the protein sequence

Description

Length: 112 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92792	2.1e-46	100.0	transgelin vari...	Homo sapiens
XP_861115	1.4e-37	95.9	similar to tran...	Canis lupus fam...
BAD96722	6.5e-37	100.0	transgelin vari...	Homo sapiens
Q01995	7.1e-37	100.0	Transgelin; Smo...	Homo sapiens
CAG38723	7.1e-37	100.0	TAGLN [Homo sap...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR003247	1	44	PD001527	Calponin-like actin-binding subtype
FPrintScan	IPR001061	2	17	PR00890	Transgelin (SM22-alpha)
	IPR001061	25	38	PR00890	Transgelin (SM22-alpha)
	IPR003096	29	45	PR00888	SM22/calponin
	IPR003096	45	60	PR00888	SM22/calponin
	IPR001061	59	68	PR00890	Transgelin (SM22-alpha)
	IPR003096	66	80	PR00888	SM22/calponin
	IPR001061	76	95	PR00890	Transgelin (SM22-alpha)
HMMPfam	IPR001715	1	78	PF00307	Calponin-like actin-binding
HMMSmart	IPR001715	1	73	SM00033	Calponin-like actin-binding
ProfileScan	IPR001715	1	77	PS50021	Calponin-like actin-binding

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp