Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07073
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226140
Product ID ORK07073
Clone name ph00240
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TCEA2
cDNA sequence DNA sequence (4765 bp)
Predicted protein sequence (136 aa)
Description Transcription elongation factor A protein 2 (Transcription elongation factor S-II protein 2) (Testis-specific S-II) (Transcription elongation factor TFIIS.l).
Features of the cloned cDNA sequence

Length: 4765 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 892 bp
Genome contig ID gi51511747f_62067670
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AAGTGCAGGAAAAAGAACTGCACCTACACACAGGT
Flanking genome sequence
(104766 - 104815)
----+----*----+----*----+----*----+----*----+----*
GAGCGGCCGCTGGGCACCCTCCCCCGGGCCCGGTGTCTTCAGGGCATCTG

Features of the protein sequence

Length: 136 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001152936 7.2e-12 75.0 similar to tran...
Pan troglodytes
AAH50623 3.1e-11 95.6 TCEA2 protein [...
Homo sapiens
CAI13200 3.1e-11 95.6 transcription e...
Homo sapiens
CAD11900 3.3e-11 95.6 transcription e...
Homo sapiens
BAG51383 3.3e-11 95.6 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003618 33 52 PF07500 Transcription elongation factor S-II
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp