Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07100
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209159
Product ID ORK07100
Clone name aj00807
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TG
cDNA sequence DNA sequence (5065 bp)
Predicted protein sequence (1574 aa)
Description Thyroglobulin precursor.
Features of the cloned cDNA sequence

Length: 5065 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 103 bp
Genome contig ID gi51511724f_133879116
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GCCACTTACCTTCAATAAAGTATCTACATGCGGTG
Flanking genome sequence
(337209 - 337258)
----+----*----+----*----+----*----+----*----+----*
AAGCATTGTTGACTCTAATGTGTGAATCCAAGGCAATTCGTTGGTAACAC

Features of the protein sequence

Length: 1574 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92396 0 100.0 Thyroglobulin p...
Homo sapiens
EAW92157 0 99.9 thyroglobulin, ...
Homo sapiens
AAI40934 0 99.8 Thyroglobulin [...
Homo sapiens
P01266 0 99.7 Thyroglobulin; ...
Homo sapiens
AAC51924 0 99.8 thyroglobulin [...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR011641 271 316 PF07699 GCC2 and GCC3
IPR002018 994 1524 PF00135 Carboxylesterase
HMMSmart IPR000716 326 375 SM00211 Thyroglobulin type-1
ProfileScan IPR000716 317 371 PS51162 Thyroglobulin type-1
ScanRegExp IPR000716 325 354 PS00484 Thyroglobulin type-1
IPR002018 1085 1095 PS00941 Carboxylesterase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp