ORK07172

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07172

Order Kazusa clone(s) from :

Accession No	AB209338
Product ID	ORK07172
Clone name	fh12337
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TNK2
cDNA sequence	DNA sequence (5833 bp) Predicted protein sequence (400 aa)
Description	Activated CDC42 kinase 1 (EC 2.7.10.2) (ACK-1) (Tyrosine kinase non- receptor protein 2).

Features of the cloned cDNA sequence

Description

Length: 5833 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1857 bp
Genome contig ID	gi89161205r_196979493
PolyA signal sequence (None)	+--------+--------+----*----+---- AGGGCCAGACCAACTACGCCTTTGTGCCTGAGCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GCGCGGCCGCCCCCTCCCCTGGAGGACAACCTGTTCCTCCCGCCCCAGGG

Features of the protein sequence

Description

Length: 400 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92575	2.5e-169	100.0	Hypothetical pr...	Homo sapiens
BAD18675	5.5e-153	93.7	unnamed protein...	Homo sapiens
NP_001010938	5.5e-153	93.7	activated CDC42...	Homo sapiens
Q07912	7.3e-152	94.6	Activated CDC42...	Homo sapiens
EAW50333	7.3e-152	94.6	tyrosine kinase...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	29	254	PD000001	Protein kinase
FPrintScan	IPR001245	81	94	PR00109	Tyrosine protein kinase
	IPR001245	118	136	PR00109	Tyrosine protein kinase
	IPR001245	168	178	PR00109	Tyrosine protein kinase
	IPR001245	187	209	PR00109	Tyrosine protein kinase
	IPR001245	232	254	PR00109	Tyrosine protein kinase
	IPR001452	267	277	PR00452	Src homology-3
	IPR001452	279	294	PR00452	Src homology-3
	IPR001452	297	306	PR00452	Src homology-3
	IPR001452	310	322	PR00452	Src homology-3
HMMPfam	IPR001245	12	261	PF07714	Tyrosine protein kinase
	IPR001452	267	322	PF00018	Src homology-3
	IPR015116	323	390	PF09027	GTPase binding
HMMSmart	IPR001245	12	261	SM00219	Tyrosine protein kinase
	IPR002290	16	261	SM00220	Serine/threonine protein kinase
	IPR001452	267	323	SM00326	Src homology-3
ProfileScan	IPR000719	1	261	PS50011	Protein kinase
ProfileScan	IPR001452	249	324	PS50002	Src homology-3
ScanRegExp	IPR008266	124	136	PS00109	Tyrosine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp