Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07172
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209338
Product ID ORK07172
Clone name fh12337
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TNK2
cDNA sequence DNA sequence (5833 bp)
Predicted protein sequence (400 aa)
Description Activated CDC42 kinase 1 (EC 2.7.10.2) (ACK-1) (Tyrosine kinase non- receptor protein 2).
Features of the cloned cDNA sequence

Length: 5833 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1857 bp
Genome contig ID gi89161205r_196979493
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGGGCCAGACCAACTACGCCTTTGTGCCTGAGCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GCGCGGCCGCCCCCTCCCCTGGAGGACAACCTGTTCCTCCCGCCCCAGGG

Features of the protein sequence

Length: 400 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92575 2.5e-169 100.0 Hypothetical pr...
Homo sapiens
BAD18675 5.5e-153 93.7 unnamed protein...
Homo sapiens
NP_001010938 5.5e-153 93.7 activated CDC42...
Homo sapiens
Q07912 7.3e-152 94.6 Activated CDC42...
Homo sapiens
EAW50333 7.3e-152 94.6 tyrosine kinase...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 29 254 PD000001 Protein kinase
FPrintScan IPR001245 81 94 PR00109 Tyrosine protein kinase
IPR001245 118 136 PR00109 Tyrosine protein kinase
IPR001245 168 178 PR00109 Tyrosine protein kinase
IPR001245 187 209 PR00109 Tyrosine protein kinase
IPR001245 232 254 PR00109 Tyrosine protein kinase
IPR001452 267 277 PR00452 Src homology-3
IPR001452 279 294 PR00452 Src homology-3
IPR001452 297 306 PR00452 Src homology-3
IPR001452 310 322 PR00452 Src homology-3
HMMPfam IPR001245 12 261 PF07714 Tyrosine protein kinase
IPR001452 267 322 PF00018 Src homology-3
IPR015116 323 390 PF09027 GTPase binding
HMMSmart IPR001245 12 261 SM00219 Tyrosine protein kinase
IPR002290 16 261 SM00220 Serine/threonine protein kinase
IPR001452 267 323 SM00326 Src homology-3
ProfileScan IPR000719 1 261 PS50011 Protein kinase
IPR001452 249 324 PS50002 Src homology-3
ScanRegExp IPR008266 124 136 PS00109 Tyrosine protein kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp