Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07173
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209339
Product ID ORK07173
Clone name fh12505
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TNKS
cDNA sequence DNA sequence (5326 bp)
Predicted protein sequence (1055 aa)
Description Tankyrase-1 (EC 2.4.2.30) (TANK1) (Tankyrase I) (TNKS-1) (TRF1- interacting ankyrin-related ADP-ribose polymerase).
Features of the cloned cDNA sequence

Length: 5326 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2157 bp
Genome contig ID gi51511724f_9375221
PolyA signal sequence
(ATTAAA,-23)		 
+----*----+----*----+----*----+----
CTTTATGGCTTCATTAAAAAGATAAACCACTACCT
Flanking genome sequence
(298595 - 298644)		 
----+----*----+----*----+----*----+----*----+----*
AACTGTGGTTGTATGTTGTTTCCATCATACTAACTAGATGAATGGATGCG

Features of the protein sequence

Length: 1055 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92576 0 100.0 tankyrase, TRF1...
 Homo sapiens
NP_003738 0 100.0 tankyrase-1 [Ho...
 Homo sapiens
AAC79842 0 99.9 TRF1-interactin...
 Homo sapiens
O95271 0 99.9 Tankyrase-1; Sh...
 Homo sapiens
XP_001137443 0 99.9 tankyrase, TRF1...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002110 130 142 PR01415 Ankyrin
IPR002110 142 154 PR01415 Ankyrin
HMMPfam IPR002110 1 8 PF00023 Ankyrin
IPR002110 9 41 PF00023 Ankyrin
IPR002110 96 128 PF00023 Ankyrin
IPR002110 129 161 PF00023 Ankyrin
IPR002110 162 194 PF00023 Ankyrin
IPR002110 249 284 PF00023 Ankyrin
IPR002110 285 317 PF00023 Ankyrin
IPR002110 318 350 PF00023 Ankyrin
IPR002110 377 408 PF00023 Ankyrin
IPR002110 411 443 PF00023 Ankyrin
IPR002110 444 476 PF00023 Ankyrin
IPR002110 477 509 PF00023 Ankyrin
IPR002110 510 541 PF00023 Ankyrin
IPR002110 564 596 PF00023 Ankyrin
IPR002110 597 629 PF00023 Ankyrin
IPR002110 630 662 PF00023 Ankyrin
IPR002110 663 671 PF00023 Ankyrin
IPR011510 752 817 PF07647 Sterile alpha motif homology 2
IPR001290 872 1038 PF00644 Poly(ADP-ribose) polymerase
HMMSmart IPR002110 9 38 SM00248 Ankyrin
IPR002110 62 90 SM00248 Ankyrin
IPR002110 96 125 SM00248 Ankyrin
IPR002110 129 158 SM00248 Ankyrin
IPR002110 162 191 SM00248 Ankyrin
IPR002110 249 281 SM00248 Ankyrin
IPR002110 285 314 SM00248 Ankyrin
IPR002110 318 347 SM00248 Ankyrin
IPR002110 377 405 SM00248 Ankyrin
IPR002110 411 440 SM00248 Ankyrin
IPR002110 444 473 SM00248 Ankyrin
IPR002110 477 506 SM00248 Ankyrin
IPR002110 564 593 SM00248 Ankyrin
IPR002110 597 626 SM00248 Ankyrin
IPR002110 630 659 SM00248 Ankyrin
IPR001660 752 817 SM00454 Sterile alpha motif SAM
ProfileScan IPR002110 1 671 PS50297 Ankyrin
IPR002110 9 41 PS50088 Ankyrin
IPR002110 96 128 PS50088 Ankyrin
IPR002110 129 161 PS50088 Ankyrin
IPR002110 162 194 PS50088 Ankyrin
IPR002110 249 284 PS50088 Ankyrin
IPR002110 285 317 PS50088 Ankyrin
IPR002110 318 350 PS50088 Ankyrin
IPR002110 411 443 PS50088 Ankyrin
IPR002110 444 476 PS50088 Ankyrin
IPR002110 477 509 PS50088 Ankyrin
IPR002110 564 596 PS50088 Ankyrin
IPR002110 597 629 PS50088 Ankyrin
IPR002110 630 662 PS50088 Ankyrin
IPR001660 758 817 PS50105 Sterile alpha motif SAM
IPR012317 840 1045 PS51059 PARP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp