Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07179
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209238
Product ID ORK07179
Clone name fj15762
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TNS1
cDNA sequence DNA sequence (4292 bp)
Predicted protein sequence (873 aa)
Description Tensin-1.
Features of the cloned cDNA sequence

Length: 4292 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1670 bp
Genome contig ID gi89161199r_218275757
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AGAATCTGTAAGCTAATAAAATGTAAGAAAAGGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGAATAGGTAAATTGACAAGAAGTATTTATTGTTTTTCCATATT

Features of the protein sequence

Length: 873 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92475 0 100.0 tensin variant ...
Homo sapiens
AAI16189 0 98.9 TNS1 protein [H...
Homo sapiens
AAI26911 0 98.8 TNS1 protein [H...
Homo sapiens
AAI16188 0 98.1 TNS1 protein [H...
Homo sapiens
Q9GLM4 0 93.3 Tensin-1.
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000980 601 713 PD000093 SH2 motif
HMMPfam IPR000980 601 695 PF00017 SH2 motif
IPR013625 736 872 PF08416 Tensin phosphotyrosine-binding domain
HMMSmart IPR000980 599 701 SM00252 SH2 motif
IPR006020 732 873 SM00462 Phosphotyrosine interaction region
ProfileScan IPR000980 601 710 PS50001 SH2 motif
ScanRegExp IPR000209 117 127 PS00138 Peptidase S8 and S53
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp