ORK07208

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07208

Order Kazusa clone(s) from :

Accession No	AK226115
Product ID	ORK07208
Clone name	hh00788
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TRIM69
cDNA sequence	DNA sequence (5688 bp) Predicted protein sequence (354 aa)
Description	Tripartite motif-containing protein 69 (RING finger protein 36) (RFP- like domain-containing protein trimless).

Features of the cloned cDNA sequence

Description

Length: 5688 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	55 bp
Genome contig ID	gi51511731f_42732758
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- ATTCAGAGTGTTATTAAAGAGGTTTTGAAATATTT
Flanking genome sequence (114561 - 114610)	----+--------+--------+--------+--------+----* TACCAGTCTCACTGGATTCTCTTCTCAATTTTTGGGGAACTATGGAATAA

Features of the protein sequence

Description

Length: 354 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
ACE86772	2.7e-128	96.2	tripartite moti...	synthetic construct
AAH33314	2.7e-128	96.2	Tripartite moti...	Homo sapiens
Q86WT6	3.7e-128	96.2	Tripartite moti...	Homo sapiens
ABB18376	3.7e-128	96.2	tripartite moti...	Homo sapiens
BAF84941	7.8e-128	95.9	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003879	175	192	PR01407	Butyrophylin-like
	IPR003879	192	209	PR01407	Butyrophylin-like
	IPR003879	214	238	PR01407	Butyrophylin-like
	IPR003879	244	257	PR01407	Butyrophylin-like
	IPR003879	288	312	PR01407	Butyrophylin-like
	IPR003879	318	336	PR01407	Butyrophylin-like
HMMPfam	IPR003877	229	354	PF00622	SPla/RYanodine receptor SPRY
HMMSmart	IPR006574	176	228	SM00589	SPRY-associated
HMMSmart	IPR003877	229	354	SM00449	SPla/RYanodine receptor SPRY
ProfileScan	IPR001870	159	354	PS50188	B302

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp