Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07243
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209845
Product ID ORK07243
Clone name ef00878
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TTF2
cDNA sequence DNA sequence (7598 bp)
Predicted protein sequence (165 aa)
Description Transcription termination factor 2 (EC 3.6.1.-) (RNA polymerase II termination factor) (Transcription release factor 2) (Factor 2) (F2) (HuF2) (Lodestar homolog).
Features of the cloned cDNA sequence

Length: 7598 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 6636 bp
Genome contig ID gi89161185f_117332699
PolyA signal sequence
(AATACA,-21)
+----*----+----*----+----*----+----
TTTCCAGCCTGGGCAATACAGTGAGACCCTGTCTC
Flanking genome sequence
(113589 - 113638)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGGAAAAAAAAGCTCAAAAAGTTCTGTGTTGCCTTTCTCTTCTT

Features of the protein sequence

Length: 165 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93082 4.2e-72 100.0 transcription t...
Homo sapiens
AAD49435 1.1e-45 99.1 lodestar protei...
Homo sapiens
AAC64044 1.1e-45 99.1 RNA polymerase ...
Homo sapiens
Q9UNY4 1.1e-45 99.1 Transcription t...
Homo sapiens
XP_513683 1.1e-45 99.1 transcription t...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000330 9 110 PF00176 SNF2-related
ScanRegExp IPR002464 15 24 PS00690 DNA/RNA helicase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp