Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07370
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209723
Product ID ORK07370
Clone name bm01965
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol WRNIP1
cDNA sequence DNA sequence (2404 bp)
Predicted protein sequence (646 aa)
Description ATPase WRNIP1 (Werner helicase-interacting protein 1).
Features of the cloned cDNA sequence

Length: 2404 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 462 bp
Genome contig ID gi89161210f_2610900
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AAAGGTCTTACGAGCCAATAAAACTATTTCAAAGT
Flanking genome sequence
(120079 - 120128)
----+----*----+----*----+----*----+----*----+----*
ACTCTTCGATTCTGTCATGGTTTTCCTGCCTGGATGCTAGGTACCAGCGT

Features of the protein sequence

Length: 646 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92960 7.6e-216 100.0 Werner helicase...
Homo sapiens
Q96S55 6.6e-215 99.3 ATPase WRNIP1; ...
Homo sapiens
XP_001090684 1.5e-214 99.0 similar to Wern...
Macaca mulatta
BAD97313 1.7e-214 99.2 Werner helicase...
Homo sapiens
BAB60709 7.2e-214 98.7 Werner helicase...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003959 244 380 PF00004 AAA ATPase
HMMSmart IPR006642 2 25 SM00734 Zinc finger
IPR003593 241 361 SM00382 AAA+ ATPase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp