Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07419
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226132
Product ID ORK07419
Clone name fh08818
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF106
cDNA sequence DNA sequence (5660 bp)
Predicted protein sequence (1148 aa)
Description Zinc finger protein 106 homolog (Zfp-106) (Zinc finger protein 474).
Features of the cloned cDNA sequence

Length: 5660 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2166 bp
Genome contig ID gi51511731r_40394912
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
CTCCAGCCTGGGCGACAAGAGTGAAACTCCACCTC
Flanking genome sequence
(99717 - 99668)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGAGTTAATCTAGGAGATAATGAATGGCCTAGTAC

Features of the protein sequence

Length: 1148 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAD91147 0 97.4 hypothetical pr...
 Homo sapiens
CAD89926 0 97.4 hypothetical pr...
 Homo sapiens
CAD91149 0 97.4 hypothetical pr...
 Homo sapiens
Q9H2Y7 0 97.4 Zinc finger pro...
 Homo sapiens
CAD91142 0 97.3 hypothetical pr...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001680 786 822 PF00400 WD40 repeat
IPR001680 826 867 PF00400 WD40 repeat
IPR001680 912 951 PF00400 WD40 repeat
IPR001680 955 991 PF00400 WD40 repeat
IPR001680 995 1031 PF00400 WD40 repeat
IPR001680 1035 1067 PF00400 WD40 repeat
IPR007087 1078 1103 PF00096 Zinc finger
HMMSmart IPR015880 42 66 SM00355 Zinc finger
IPR001680 785 822 SM00320 WD40 repeat
IPR001680 825 867 SM00320 WD40 repeat
IPR001680 909 951 SM00320 WD40 repeat
IPR001680 954 991 SM00320 WD40 repeat
IPR001680 994 1031 SM00320 WD40 repeat
IPR001680 1034 1071 SM00320 WD40 repeat
IPR015880 1078 1103 SM00355 Zinc finger
IPR015880 1111 1139 SM00355 Zinc finger
ProfileScan IPR001680 792 831 PS50082 WD40 repeat
IPR001680 792 1080 PS50294 WD40 repeat
IPR001680 832 876 PS50082 WD40 repeat
ScanRegExp IPR007087 44 66 PS00028 Zinc finger
IPR007087 1080 1103 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp