Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07422
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209673
Product ID ORK07422
Clone name pf04127
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol RBSN
cDNA sequence DNA sequence (2851 bp)
Predicted protein sequence (768 aa)
Description Rabenosyn-5 (FYVE finger-containing Rab5 effector protein rabenosyn-5) (Zinc finger FYVE domain-containing protein 20) (110 kDa protein).
Features of the cloned cDNA sequence

Length: 2851 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi89161205r_14990380
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACATCAAGGCATACATCTTTGATGCCAAGCAGTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GGCCGCCTGGATGAGGTAGAGGTGCTGACAGAGAATCTGCGGGAGCTGAA

Features of the protein sequence

Length: 768 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92910 0 100.0 FYVE-finger-con...
Homo sapiens
Q9H1K0 0 100.0 Rabenosyn-5; FY...
Homo sapiens
BAF83977 0 99.8 unnamed protein...
Homo sapiens
AAG33246 0 99.7 FYVE-finger-con...
Homo sapiens
XP_516306 0 99.2 FYVE-finger-con...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000306 164 273 PF01363 Zinc finger
HMMSmart IPR000306 161 273 SM00064 Zinc finger
ProfileScan IPR007087 26 54 PS50157 Zinc finger
IPR000306 169 272 PS50178 Zinc finger
ScanRegExp IPR007087 28 49 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp