Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07445
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209664
Product ID ORK07445
Clone name ff11592
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF195
cDNA sequence DNA sequence (11232 bp)
Predicted protein sequence (488 aa)
Description Zinc finger protein 195.
Features of the cloned cDNA sequence

Length: 11232 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1243 bp
Genome contig ID gi51511727r_3236127
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CAGCCAAGCAGCTCAATAAAGCTTGCTTGCCTGAC
Flanking genome sequence
(93894 - 93845)
----+----*----+----*----+----*----+----*----+----*
TTTGGGTCTCCTCATCCTTTCTCTCGGCTGACCTTACACCTGCATTATAG

Features of the protein sequence

Length: 488 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92901 3.7e-212 100.0 Hypothetical pr...
Homo sapiens
AAI21030 4.4e-210 99.7 ZNF195 protein ...
Homo sapiens
EAX02548 1.5e-209 99.5 zinc finger pro...
Homo sapiens
CAH56261 1.8e-209 100.0 hypothetical pr...
Homo sapiens
O14628 5.4e-209 99.1 Zinc finger pro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 103 126 PD000003 Zinc finger
IPR007087 269 292 PD000003 Zinc finger
IPR007087 297 320 PD000003 Zinc finger
IPR007087 325 348 PD000003 Zinc finger
IPR007087 353 376 PD000003 Zinc finger
IPR007087 381 404 PD000003 Zinc finger
IPR007087 409 432 PD000003 Zinc finger
IPR007087 437 460 PD000003 Zinc finger
IPR007087 465 488 PD000003 Zinc finger
HMMPfam IPR007087 103 125 PF00096 Zinc finger
IPR007087 269 291 PF00096 Zinc finger
IPR007087 297 319 PF00096 Zinc finger
IPR007087 325 347 PF00096 Zinc finger
IPR007087 353 375 PF00096 Zinc finger
IPR007087 381 403 PF00096 Zinc finger
IPR007087 409 431 PF00096 Zinc finger
IPR007087 437 459 PF00096 Zinc finger
IPR007087 465 487 PF00096 Zinc finger
HMMSmart IPR015880 103 125 SM00355 Zinc finger
IPR015880 269 291 SM00355 Zinc finger
IPR015880 297 319 SM00355 Zinc finger
IPR015880 325 347 SM00355 Zinc finger
IPR015880 353 375 SM00355 Zinc finger
IPR015880 381 403 SM00355 Zinc finger
IPR015880 409 431 SM00355 Zinc finger
IPR015880 437 459 SM00355 Zinc finger
IPR015880 465 487 SM00355 Zinc finger
ProfileScan IPR007087 103 130 PS50157 Zinc finger
IPR007087 131 158 PS50157 Zinc finger
IPR007087 269 296 PS50157 Zinc finger
IPR007087 297 324 PS50157 Zinc finger
IPR007087 325 352 PS50157 Zinc finger
IPR007087 353 380 PS50157 Zinc finger
IPR007087 381 408 PS50157 Zinc finger
IPR007087 409 436 PS50157 Zinc finger
IPR007087 437 464 PS50157 Zinc finger
IPR007087 465 488 PS50157 Zinc finger
ScanRegExp IPR007087 105 125 PS00028 Zinc finger
IPR007087 271 291 PS00028 Zinc finger
IPR007087 299 319 PS00028 Zinc finger
IPR007087 327 347 PS00028 Zinc finger
IPR007087 355 375 PS00028 Zinc finger
IPR007087 383 403 PS00028 Zinc finger
IPR007087 411 431 PS00028 Zinc finger
IPR007087 439 459 PS00028 Zinc finger
IPR007087 467 487 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp