Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07467
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209520
Product ID ORK07467
Clone name fk09522
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF41
cDNA sequence DNA sequence (3544 bp)
Predicted protein sequence (698 aa)
Description Zinc finger protein 41.
Features of the cloned cDNA sequence

Length: 3544 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 728 bp
Genome contig ID gi89161218r_47091045
PolyA signal sequence
(AATATA,-27)
+----*----+----*----+----*----+----
GTTACAGAAATATAGTCATTGAATGATACAGACAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATAAAGGTAGTAGTTGTCTCATTATTAATTCCCTGCTGGGAGAGCAGATG

Features of the protein sequence

Length: 698 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92757 0 100.0 zinc finger pro...
Homo sapiens
BAG57962 0 99.8 unnamed protein...
Homo sapiens
CAB51740 0 99.8 zinc finger 41 ...
Homo sapiens
EAW59300 0 99.8 zinc finger pro...
Homo sapiens
EAW59305 0 99.8 zinc finger pro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 246 269 PD000003 Zinc finger
IPR007087 274 297 PD000003 Zinc finger
IPR007087 302 325 PD000003 Zinc finger
IPR007087 330 353 PD000003 Zinc finger
IPR007087 358 381 PD000003 Zinc finger
IPR007087 386 409 PD000003 Zinc finger
IPR007087 414 437 PD000003 Zinc finger
IPR007087 442 465 PD000003 Zinc finger
IPR007087 470 492 PD000003 Zinc finger
IPR007087 498 521 PD000003 Zinc finger
IPR007087 526 549 PD000003 Zinc finger
IPR007087 554 577 PD000003 Zinc finger
IPR007087 583 605 PD000003 Zinc finger
IPR007087 610 633 PD000003 Zinc finger
IPR007087 638 661 PD000003 Zinc finger
IPR007087 666 689 PD000003 Zinc finger
HMMPfam IPR007087 190 212 PF00096 Zinc finger
IPR007087 246 268 PF00096 Zinc finger
IPR007087 274 296 PF00096 Zinc finger
IPR007087 302 324 PF00096 Zinc finger
IPR007087 330 352 PF00096 Zinc finger
IPR007087 358 380 PF00096 Zinc finger
IPR007087 386 408 PF00096 Zinc finger
IPR007087 414 436 PF00096 Zinc finger
IPR007087 442 464 PF00096 Zinc finger
IPR007087 470 492 PF00096 Zinc finger
IPR007087 498 520 PF00096 Zinc finger
IPR007087 526 548 PF00096 Zinc finger
IPR007087 554 576 PF00096 Zinc finger
IPR007087 610 632 PF00096 Zinc finger
IPR007087 638 660 PF00096 Zinc finger
IPR007087 666 688 PF00096 Zinc finger
HMMSmart IPR015880 190 212 SM00355 Zinc finger
IPR015880 246 268 SM00355 Zinc finger
IPR015880 274 296 SM00355 Zinc finger
IPR015880 302 324 SM00355 Zinc finger
IPR015880 330 352 SM00355 Zinc finger
IPR015880 358 380 SM00355 Zinc finger
IPR015880 386 408 SM00355 Zinc finger
IPR015880 414 436 SM00355 Zinc finger
IPR015880 442 464 SM00355 Zinc finger
IPR015880 470 492 SM00355 Zinc finger
IPR015880 498 520 SM00355 Zinc finger
IPR015880 526 548 SM00355 Zinc finger
IPR015880 554 576 SM00355 Zinc finger
IPR015880 582 604 SM00355 Zinc finger
IPR015880 610 632 SM00355 Zinc finger
IPR015880 638 660 SM00355 Zinc finger
IPR015880 666 688 SM00355 Zinc finger
ProfileScan IPR007087 190 217 PS50157 Zinc finger
IPR007087 218 245 PS50157 Zinc finger
IPR007087 246 273 PS50157 Zinc finger
IPR007087 274 301 PS50157 Zinc finger
IPR007087 302 329 PS50157 Zinc finger
IPR007087 330 357 PS50157 Zinc finger
IPR007087 358 385 PS50157 Zinc finger
IPR007087 386 413 PS50157 Zinc finger
IPR007087 414 441 PS50157 Zinc finger
IPR007087 442 469 PS50157 Zinc finger
IPR007087 470 497 PS50157 Zinc finger
IPR007087 498 525 PS50157 Zinc finger
IPR007087 526 553 PS50157 Zinc finger
IPR007087 554 581 PS50157 Zinc finger
IPR007087 582 609 PS50157 Zinc finger
IPR007087 610 637 PS50157 Zinc finger
IPR007087 638 665 PS50157 Zinc finger
IPR007087 666 693 PS50157 Zinc finger
ScanRegExp IPR007087 192 212 PS00028 Zinc finger
IPR007087 248 268 PS00028 Zinc finger
IPR007087 276 296 PS00028 Zinc finger
IPR007087 304 324 PS00028 Zinc finger
IPR007087 332 352 PS00028 Zinc finger
IPR007087 360 380 PS00028 Zinc finger
IPR007087 388 408 PS00028 Zinc finger
IPR007087 416 436 PS00028 Zinc finger
IPR007087 444 464 PS00028 Zinc finger
IPR007087 472 492 PS00028 Zinc finger
IPR007087 500 520 PS00028 Zinc finger
IPR007087 528 548 PS00028 Zinc finger
IPR007087 556 576 PS00028 Zinc finger
IPR007087 612 632 PS00028 Zinc finger
IPR007087 640 660 PS00028 Zinc finger
IPR007087 668 688 PS00028 Zinc finger

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 2 LLIVLCVVFISFIFFLGEAIGKM 24 PRIMARY 23
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp