Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07493
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226080
Product ID ORK07493
Clone name ej00969
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ZNF544
cDNA sequence DNA sequence (4129 bp)
Predicted protein sequence (642 aa)
Description Zinc finger protein 544.
Features of the cloned cDNA sequence

Length: 4129 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 725 bp
Genome contig ID gi42406306f_63332643
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTGAGACACTCTAAATAAATAATAACCAAGATGGG
Flanking genome sequence
(134016 - 134065)
----+----*----+----*----+----*----+----*----+----*
AAATTTCCCTGCCAGACCTTGTTTACTAGAAATCAGGTGGCCAAAACATG

Features of the protein sequence

Length: 642 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q6NX49 0 100.0 Zinc finger pro...
Homo sapiens
EAW72568 0 99.8 zinc finger pro...
Homo sapiens
AAC01956 0 99.0 zinc finger pro...
Homo sapiens
BAF82986 0 99.6 unnamed protein...
Homo sapiens
XP_001495260 8.4e-134 65.1 similar to zinc...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 307 330 PD000003 Zinc finger
IPR007087 335 358 PD000003 Zinc finger
IPR007087 363 386 PD000003 Zinc finger
IPR007087 391 414 PD000003 Zinc finger
IPR007087 419 442 PD000003 Zinc finger
IPR007087 447 470 PD000003 Zinc finger
IPR007087 475 498 PD000003 Zinc finger
IPR007087 503 526 PD000003 Zinc finger
IPR007087 531 554 PD000003 Zinc finger
IPR007087 559 582 PD000003 Zinc finger
IPR007087 587 610 PD000003 Zinc finger
IPR007087 615 638 PD000003 Zinc finger
HMMPfam IPR007087 307 329 PF00096 Zinc finger
IPR007087 335 357 PF00096 Zinc finger
IPR007087 363 385 PF00096 Zinc finger
IPR007087 391 413 PF00096 Zinc finger
IPR007087 419 441 PF00096 Zinc finger
IPR007087 447 469 PF00096 Zinc finger
IPR007087 475 497 PF00096 Zinc finger
IPR007087 503 525 PF00096 Zinc finger
IPR007087 531 553 PF00096 Zinc finger
IPR007087 559 581 PF00096 Zinc finger
IPR007087 587 609 PF00096 Zinc finger
IPR007087 615 637 PF00096 Zinc finger
HMMSmart IPR015880 307 329 SM00355 Zinc finger
IPR015880 335 357 SM00355 Zinc finger
IPR015880 363 385 SM00355 Zinc finger
IPR015880 391 413 SM00355 Zinc finger
IPR015880 419 441 SM00355 Zinc finger
IPR015880 447 469 SM00355 Zinc finger
IPR015880 475 497 SM00355 Zinc finger
IPR015880 503 525 SM00355 Zinc finger
IPR015880 531 553 SM00355 Zinc finger
IPR015880 559 581 SM00355 Zinc finger
IPR015880 587 609 SM00355 Zinc finger
IPR015880 615 637 SM00355 Zinc finger
ProfileScan IPR007087 281 306 PS50157 Zinc finger
IPR007087 307 334 PS50157 Zinc finger
IPR007087 335 362 PS50157 Zinc finger
IPR007087 363 390 PS50157 Zinc finger
IPR007087 391 418 PS50157 Zinc finger
IPR007087 419 446 PS50157 Zinc finger
IPR007087 447 474 PS50157 Zinc finger
IPR007087 475 502 PS50157 Zinc finger
IPR007087 503 530 PS50157 Zinc finger
IPR007087 531 558 PS50157 Zinc finger
IPR007087 559 586 PS50157 Zinc finger
IPR007087 587 614 PS50157 Zinc finger
IPR007087 615 642 PS50157 Zinc finger
ScanRegExp IPR007087 309 329 PS00028 Zinc finger
IPR007087 337 357 PS00028 Zinc finger
IPR007087 365 385 PS00028 Zinc finger
IPR007087 393 413 PS00028 Zinc finger
IPR007087 421 441 PS00028 Zinc finger
IPR007087 449 469 PS00028 Zinc finger
IPR007087 477 497 PS00028 Zinc finger
IPR007087 505 525 PS00028 Zinc finger
IPR007087 533 553 PS00028 Zinc finger
IPR007087 561 581 PS00028 Zinc finger
IPR007087 589 609 PS00028 Zinc finger
IPR007087 617 637 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp