Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07507
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209706
Product ID ORK07507
Clone name bm01294
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ZNF692
cDNA sequence DNA sequence (2026 bp)
Predicted protein sequence (252 aa)
Description Zinc finger protein 692.
Features of the cloned cDNA sequence

Length: 2026 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 201 bp
Genome contig ID gi89161185r_247010831
PolyA signal sequence
(AATAAA,-19)		 
+----*----+----*----+----*----+----
TCTTCCTAAAGGACAAAATAAACAGTATTTTATGC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AGGCATGTGTGGGCAGAGCAAGTGTTTTGGCACCTGAGGTGCAGAAATCC

Features of the protein sequence

Length: 252 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92943 2.9e-99 100.0 hypothetical pr...
 Homo sapiens
AAG15327 7.6e-88 93.8 unknown [Homo s...
 Homo sapiens
EAW57539 7.9e-88 93.8 zinc finger pro...
 Homo sapiens
XP_001136529 8.4e-88 93.8 hypothetical pr...
 Pan troglodytes
CAI18801 8.4e-88 93.8 zinc finger pro...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 92 117 PD000003 Zinc finger
IPR007087 122 145 PD000003 Zinc finger
HMMPfam IPR007087 61 86 PF00096 Zinc finger
IPR007087 92 116 PF00096 Zinc finger
IPR007087 122 144 PF00096 Zinc finger
IPR007087 150 172 PF00096 Zinc finger
IPR007087 181 204 PF00096 Zinc finger
HMMSmart IPR015880 61 86 SM00355 Zinc finger
IPR015880 92 116 SM00355 Zinc finger
IPR015880 122 144 SM00355 Zinc finger
IPR015880 150 172 SM00355 Zinc finger
IPR015880 181 204 SM00355 Zinc finger
ProfileScan IPR007087 61 91 PS50157 Zinc finger
IPR007087 92 121 PS50157 Zinc finger
IPR007087 122 149 PS50157 Zinc finger
IPR007087 150 177 PS50157 Zinc finger
IPR007087 181 204 PS50157 Zinc finger
ScanRegExp IPR007087 63 86 PS00028 Zinc finger
IPR007087 94 116 PS00028 Zinc finger
IPR007087 124 144 PS00028 Zinc finger
IPR007087 152 172 PS00028 Zinc finger
IPR007087 183 204 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp