Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07511
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209663
Product ID ORK07511
Clone name ff11569
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF74
cDNA sequence DNA sequence (3743 bp)
Predicted protein sequence (606 aa)
Description Zinc finger protein 74 (hZNF7).
Features of the cloned cDNA sequence

Length: 3743 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1486 bp
Genome contig ID gi89161203f_18978693
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
CCATAATTCTTAATAAAACTGCCTTTTGCACTTTG
Flanking genome sequence
(114053 - 114102)
----+----*----+----*----+----*----+----*----+----*
ATACATTACCCTCTGCTTTGTTCATGTAGAACTTTGCATTATTTTCAACA

Features of the protein sequence

Length: 606 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92900 0 100.0 ZNF74 protein v...
Homo sapiens
CAG30502 0 99.8 ZNF74 [Homo sap...
Homo sapiens
AAH13395 0 99.6 Zinc finger pro...
Homo sapiens
XP_530361 0 99.6 zinc finger pro...
Pan troglodytes
BAF84047 0 99.5 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 210 233 PD000003 Zinc finger
IPR007087 238 261 PD000003 Zinc finger
IPR007087 266 289 PD000003 Zinc finger
IPR007087 294 317 PD000003 Zinc finger
IPR007087 350 373 PD000003 Zinc finger
IPR007087 378 401 PD000003 Zinc finger
IPR007087 406 429 PD000003 Zinc finger
IPR007087 434 457 PD000003 Zinc finger
IPR007087 462 485 PD000003 Zinc finger
IPR007087 490 513 PD000003 Zinc finger
IPR007087 518 541 PD000003 Zinc finger
HMMPfam IPR001909 5 45 PF01352 KRAB box
IPR007087 210 232 PF00096 Zinc finger
IPR007087 238 260 PF00096 Zinc finger
IPR007087 266 288 PF00096 Zinc finger
IPR007087 294 316 PF00096 Zinc finger
IPR007087 322 344 PF00096 Zinc finger
IPR007087 350 372 PF00096 Zinc finger
IPR007087 378 400 PF00096 Zinc finger
IPR007087 406 428 PF00096 Zinc finger
IPR007087 434 456 PF00096 Zinc finger
IPR007087 462 484 PF00096 Zinc finger
IPR007087 490 512 PF00096 Zinc finger
IPR007087 518 540 PF00096 Zinc finger
HMMSmart IPR001909 5 65 SM00349 KRAB box
IPR015880 210 232 SM00355 Zinc finger
IPR015880 238 260 SM00355 Zinc finger
IPR015880 266 288 SM00355 Zinc finger
IPR015880 294 316 SM00355 Zinc finger
IPR015880 322 344 SM00355 Zinc finger
IPR015880 350 372 SM00355 Zinc finger
IPR015880 378 400 SM00355 Zinc finger
IPR015880 406 428 SM00355 Zinc finger
IPR015880 434 456 SM00355 Zinc finger
IPR015880 462 484 SM00355 Zinc finger
IPR015880 490 512 SM00355 Zinc finger
IPR015880 518 540 SM00355 Zinc finger
ProfileScan IPR001909 5 76 PS50805 KRAB box
IPR007087 210 237 PS50157 Zinc finger
IPR007087 238 265 PS50157 Zinc finger
IPR007087 266 293 PS50157 Zinc finger
IPR007087 294 321 PS50157 Zinc finger
IPR007087 322 349 PS50157 Zinc finger
IPR007087 350 377 PS50157 Zinc finger
IPR007087 378 405 PS50157 Zinc finger
IPR007087 406 433 PS50157 Zinc finger
IPR007087 434 461 PS50157 Zinc finger
IPR007087 462 489 PS50157 Zinc finger
IPR007087 490 517 PS50157 Zinc finger
IPR007087 518 545 PS50157 Zinc finger
ScanRegExp IPR007087 212 232 PS00028 Zinc finger
IPR007087 240 260 PS00028 Zinc finger
IPR007087 268 288 PS00028 Zinc finger
IPR007087 296 316 PS00028 Zinc finger
IPR007087 324 344 PS00028 Zinc finger
IPR007087 352 372 PS00028 Zinc finger
IPR007087 380 400 PS00028 Zinc finger
IPR007087 408 428 PS00028 Zinc finger
IPR007087 436 456 PS00028 Zinc finger
IPR007087 464 484 PS00028 Zinc finger
IPR007087 492 512 PS00028 Zinc finger
IPR007087 520 540 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp