Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07520
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209516
Product ID ORK07520
Clone name fk08996
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF83
cDNA sequence DNA sequence (3728 bp)
Predicted protein sequence (535 aa)
Description Zinc finger protein 83 (Zinc finger protein HPF1).
Features of the cloned cDNA sequence

Length: 3728 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 636 bp
Genome contig ID gi42406306r_57707443
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GTGAGAGATCCACTCAATAAAAACCAGGCAAATGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTGAATCTGGAAAGGTTACTAATCTAAGATGCATCCTCAGGGTTCATTA

Features of the protein sequence

Length: 535 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92753 0 100.0 Zinc finger pro...
Homo sapiens
EAW72088 0 99.8 zinc finger pro...
Homo sapiens
BAG51500 0 99.8 unnamed protein...
Homo sapiens
AAH50407 0 99.8 Zinc finger pro...
Homo sapiens
BAB55171 0 99.4 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 140 163 PD000003 Zinc finger
IPR007087 168 191 PD000003 Zinc finger
IPR007087 196 219 PD000003 Zinc finger
IPR007087 224 247 PD000003 Zinc finger
IPR007087 252 275 PD000003 Zinc finger
IPR007087 280 303 PD000003 Zinc finger
IPR007087 308 331 PD000003 Zinc finger
IPR007087 336 359 PD000003 Zinc finger
IPR007087 364 386 PD000003 Zinc finger
IPR007087 392 415 PD000003 Zinc finger
IPR007087 420 443 PD000003 Zinc finger
IPR007087 448 471 PD000003 Zinc finger
IPR007087 476 499 PD000003 Zinc finger
IPR007087 504 524 PD000003 Zinc finger
HMMPfam IPR007087 140 162 PF00096 Zinc finger
IPR007087 168 190 PF00096 Zinc finger
IPR007087 196 218 PF00096 Zinc finger
IPR007087 224 246 PF00096 Zinc finger
IPR007087 252 274 PF00096 Zinc finger
IPR007087 280 302 PF00096 Zinc finger
IPR007087 308 330 PF00096 Zinc finger
IPR007087 336 358 PF00096 Zinc finger
IPR007087 364 386 PF00096 Zinc finger
IPR007087 392 414 PF00096 Zinc finger
IPR007087 420 442 PF00096 Zinc finger
IPR007087 448 470 PF00096 Zinc finger
IPR007087 476 498 PF00096 Zinc finger
IPR007087 504 526 PF00096 Zinc finger
HMMSmart IPR015880 112 134 SM00355 Zinc finger
IPR015880 140 162 SM00355 Zinc finger
IPR015880 168 190 SM00355 Zinc finger
IPR015880 196 218 SM00355 Zinc finger
IPR015880 224 246 SM00355 Zinc finger
IPR015880 252 274 SM00355 Zinc finger
IPR015880 280 302 SM00355 Zinc finger
IPR015880 308 330 SM00355 Zinc finger
IPR015880 336 358 SM00355 Zinc finger
IPR015880 364 386 SM00355 Zinc finger
IPR015880 392 414 SM00355 Zinc finger
IPR015880 420 442 SM00355 Zinc finger
IPR015880 448 470 SM00355 Zinc finger
IPR015880 476 498 SM00355 Zinc finger
IPR015880 504 526 SM00355 Zinc finger
ProfileScan IPR007087 112 139 PS50157 Zinc finger
IPR007087 140 167 PS50157 Zinc finger
IPR007087 168 195 PS50157 Zinc finger
IPR007087 196 223 PS50157 Zinc finger
IPR007087 224 251 PS50157 Zinc finger
IPR007087 252 279 PS50157 Zinc finger
IPR007087 280 307 PS50157 Zinc finger
IPR007087 308 335 PS50157 Zinc finger
IPR007087 336 363 PS50157 Zinc finger
IPR007087 364 391 PS50157 Zinc finger
IPR007087 392 419 PS50157 Zinc finger
IPR007087 420 447 PS50157 Zinc finger
IPR007087 448 475 PS50157 Zinc finger
IPR007087 476 503 PS50157 Zinc finger
IPR007087 504 531 PS50157 Zinc finger
ScanRegExp IPR007087 142 162 PS00028 Zinc finger
IPR007087 170 190 PS00028 Zinc finger
IPR007087 198 218 PS00028 Zinc finger
IPR007087 226 246 PS00028 Zinc finger
IPR007087 254 274 PS00028 Zinc finger
IPR007087 282 302 PS00028 Zinc finger
IPR007087 310 330 PS00028 Zinc finger
IPR007087 338 358 PS00028 Zinc finger
IPR007087 366 386 PS00028 Zinc finger
IPR007087 394 414 PS00028 Zinc finger
IPR007087 422 442 PS00028 Zinc finger
IPR007087 450 470 PS00028 Zinc finger
IPR007087 478 498 PS00028 Zinc finger
IPR007087 506 526 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp