ORK07541

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07541

Order Kazusa clone(s) from :

Accession No	AB209473
Product ID	ORK07541
Clone name	ah05148
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone ah05148 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGGT) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	ARAP1
cDNA sequence	DNA sequence (5761 bp) Predicted protein sequence (1474 aa)
Description	Homo sapiens mRNA for centaurin delta 2 isoform a variant protein.

Features of the cloned cDNA sequence

Description

Length: 5761 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	589 bp
Genome contig ID	gi51511727r_71973768
PolyA signal sequence (TATAAA,-22)	+--------+--------+----*----+---- GACTTTTTGATAATATAAATATATCTGTATATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCCTATGGTGCTGAGGCCTGTGATTGGCTAAGGGGATTGGGCGTCCTGG

Features of the protein sequence

Description

Length: 1474 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92710	100.0	centaurin delta...	Homo sapiens
EAW74866	99.8	centaurin, delt...	Homo sapiens
AAT36325	99.1	ARAP1b protein ...	Homo sapiens
EAW74863	98.2	centaurin, delt...	Homo sapiens
XP_508625	98.8	centaurin delta...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	582	601	PR00405	Arf GTPase activating protein
	IPR001164	601	618	PR00405	Arf GTPase activating protein
	IPR001164	624	645	PR00405	Arf GTPase activating protein
HMMPfam	IPR001660	39	103	PF00536	Sterile alpha motif SAM
	IPR001849	363	454	PF00169	Pleckstrin-like
	IPR001164	570	694	PF01412	Arf GTPase activating protein
	IPR001849	779	885	PF00169	Pleckstrin-like
	IPR000198	1006	1155	PF00620	RhoGAP
	IPR000159	1207	1296	PF00788	Ras-association
	IPR001849	1310	1420	PF00169	Pleckstrin-like
HMMSmart	IPR001660	38	105	SM00454	Sterile alpha motif SAM
	IPR001849	363	456	SM00233	Pleckstrin-like
	IPR001849	476	566	SM00233	Pleckstrin-like
	IPR001164	570	696	SM00105	Arf GTPase activating protein
	IPR001849	779	887	SM00233	Pleckstrin-like
	IPR001849	897	991	SM00233	Pleckstrin-like
	IPR000198	1003	1179	SM00324	RhoGAP
	IPR001849	1310	1422	SM00233	Pleckstrin-like
ProfileScan	IPR001660	45	105	PS50105	Sterile alpha motif SAM
	IPR001849	362	454	PS50003	Pleckstrin-like
	IPR001849	475	564	PS50003	Pleckstrin-like
	IPR001164	570	695	PS50115	Arf GTPase activating protein
	IPR001849	778	885	PS50003	Pleckstrin-like
	IPR000198	989	1174	PS50238	RhoGAP
	IPR000159	1207	1296	PS50200	Ras-association
	IPR001849	1309	1420	PS50003	Pleckstrin-like

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp