ORK07543

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07543

Order Kazusa clone(s) from :

Accession No	AK226123
Product ID	ORK07543
Clone name	aj01160
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	BMP1
cDNA sequence	DNA sequence (4446 bp) Predicted protein sequence (374 aa)
Description	Homo sapiens mRNA for bone morphogenetic protein 1 isoform 3, precursor variant, clone: aj01160.

Features of the cloned cDNA sequence

Description

Length: 4446 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	596 bp
Genome contig ID	gi51511724f_22012265
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GGCACCGCAGCCAATAAACCGAAAGTGTTACAGCC
Flanking genome sequence (113519 - 113568)	----+--------+--------+--------+--------+----* AATATCCTGTGCCAGATGCTGTCTGGGCCATGGGGGCGGGGCCATCATGT

Features of the protein sequence

Description

Length: 374 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001154458	2.9e-117	99.6	bone morphogene...	Pan troglodytes
XP_001154512	2.9e-117	99.6	bone morphogene...	Pan troglodytes
P13497	2.9e-117	99.6	Bone morphogene...	Homo sapiens
XP_001102441	5.9e-117	99.2	bone morphogene...	Macaca mulatta
AAI42954	7.9e-117	98.9	Bone morphogene...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006209	95	130	PF00008	EGF-like
	IPR000859	135	244	PF00431	CUB
	IPR000859	248	361	PF00431	CUB
HMMSmart	IPR001881	91	131	SM00179	EGF-like calcium-binding
	IPR006210	94	131	SM00181	EGF
	IPR000859	135	247	SM00042	CUB
	IPR000859	248	364	SM00042	CUB
ProfileScan	IPR000859	135	247	PS01180	CUB
ProfileScan	IPR000859	248	364	PS01180	CUB
ScanRegExp	IPR001881	91	115	PS01187	EGF-like calcium-binding
	IPR000152	106	117	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR013032	115	130	PS01186	EGF-like region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp