Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07546
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209992
Product ID ORK07546
Clone name bf04924
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol DSP
cDNA sequence DNA sequence (7809 bp)
Predicted protein sequence (2319 aa)
Description
Features of the cloned cDNA sequence

Length: 7809 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 691 bp
Genome contig ID gi89161210f_7386849
PolyA signal sequence
(AATAAA,-20)		 
+----*----+----*----+----*----+----
GTTTGCTATTCTGGCAATAAACTTTTAGACTTTTG
Flanking genome sequence
(144957 - 145006)		 
----+----*----+----*----+----*----+----*----+----*
AAGTGTTTGTGTTTTAATTTAATATGTTTATAAGCATGTATAAACATTTA

Features of the protein sequence

Length: 2319 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06074 0 100.0 DSP variant pro...
 Homo sapiens
AAI40803 0 100.0 Desmoplakin [Ho...
 Homo sapiens
XP_001165361 0 99.7 desmoplakin [Pa...
 Pan troglodytes
XP_001084900 0 98.9 similar to desm...
 Macaca mulatta
XP_545329 0 95.9 similar to desm...
 Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001101 1494 1538 PF00681 Plectin repeat
IPR001101 1570 1614 PF00681 Plectin repeat
IPR001101 1699 1743 PF00681 Plectin repeat
IPR001101 1744 1781 PF00681 Plectin repeat
IPR001101 1813 1857 PF00681 Plectin repeat
IPR001101 1906 1948 PF00681 Plectin repeat
IPR001101 2096 2140 PF00681 Plectin repeat
IPR001101 2172 2216 PF00681 Plectin repeat
HMMSmart IPR002017 228 317 SM00150 Spectrin repeat
IPR002017 320 420 SM00150 Spectrin repeat
IPR002017 936 1065 SM00150 Spectrin repeat
IPR001101 1457 1493 SM00250 Plectin repeat
IPR001101 1494 1531 SM00250 Plectin repeat
IPR001101 1532 1569 SM00250 Plectin repeat
IPR001101 1570 1607 SM00250 Plectin repeat
IPR001101 1611 1645 SM00250 Plectin repeat
IPR001101 1646 1681 SM00250 Plectin repeat
IPR001101 1699 1736 SM00250 Plectin repeat
IPR001101 1737 1774 SM00250 Plectin repeat
IPR001101 1775 1812 SM00250 Plectin repeat
IPR001101 1813 1850 SM00250 Plectin repeat
IPR001101 1854 1888 SM00250 Plectin repeat
IPR001101 1904 1941 SM00250 Plectin repeat
IPR001101 1955 1992 SM00250 Plectin repeat
IPR001101 2058 2095 SM00250 Plectin repeat
IPR001101 2096 2133 SM00250 Plectin repeat
IPR001101 2134 2171 SM00250 Plectin repeat
IPR001101 2172 2209 SM00250 Plectin repeat
IPR001101 2210 2247 SM00250 Plectin repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp