Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07551
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209802
Product ID ORK07551
Clone name bm03574
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol RUNDC3A
cDNA sequence DNA sequence (2032 bp)
Predicted protein sequence (481 aa)
Description RUN domain containing 3A
Features of the cloned cDNA sequence

Length: 2032 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 433 bp
Genome contig ID gi51511734f_39641469
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GGCAAGAGAGCTCAAATAAAAACCAGAGGACTGAG
Flanking genome sequence
(110098 - 110147)
----+----*----+----*----+----*----+----*----+----*
GGCAGCCTTGTATGTGGGGGGCTGGGGAAGGGCCCCGTCCTGAGGTCTGA

Features of the protein sequence

Length: 481 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93039 2.8e-196 100.0 RaP2 interactin...
Homo sapiens
Q59EK9 1.2e-178 100.0 RUN domain-cont...
Homo sapiens
Q5R565 2.4e-178 99.7 RUN domain-cont...
Pongo abelii
EDM06193 5.1e-173 96.6 Rap2 interactin...
Rattus norvegicus
O08576 1.9e-172 96.4 RUN domain-cont...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004012 95 224 PF02759 RUN
HMMSmart IPR004012 160 222 SM00593 RUN
ProfileScan IPR004012 87 224 PS50826 RUN
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp