Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07558
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209730
Product ID ORK07558
Clone name bm05674
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CHERP
cDNA sequence DNA sequence (2472 bp)
Predicted protein sequence (399 aa)
Description calcium homeostasis endoplasmic reticulum protein
Features of the cloned cDNA sequence

Length: 2472 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1270 bp
Genome contig ID gi42406306r_16389717
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
TTGCCTTCAAATAAAGCCTTTTTTTAAAGACCTTT
Flanking genome sequence
(99983 - 99934)
----+----*----+----*----+----*----+----*----+----*
CTCCCGCACATGTGTAAGTCAGAAGTGTGCACGGGCTGAGTGAGGAGACA

Features of the protein sequence

Length: 399 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92967 1.1e-124 100.0 calcium homeost...
Homo sapiens
XP_512468 4.5e-124 99.7 similar to Cher...
Pan troglodytes
XP_001172928 4.5e-124 99.7 calcium homeost...
Pan troglodytes
XP_001112744 4.9e-124 99.7 similar to calc...
Macaca mulatta
AAB53327 4.9e-124 99.7 ERPROT 213-21 [...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000467 324 372 PF01585 D111/G-patch
HMMSmart IPR000467 322 372 SM00443 D111/G-patch
ProfileScan IPR000467 324 374 PS50174 D111/G-patch
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp