Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07559
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209841
Product ID ORK07559
Clone name ef00596
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MYO9A
cDNA sequence DNA sequence (8720 bp)
Predicted protein sequence (1105 aa)
Description Homo sapiens mRNA for myosin IXA variant protein.
Features of the cloned cDNA sequence

Length: 8720 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 5401 bp
Genome contig ID gi51511731r_69869243
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
TCCAGCCTGAGCAACAGAGCAAGACCATGTCTCTT
Flanking genome sequence
(99624 - 99575)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAAAAGGTTTGTTAGACCCAAACAGTAC

Features of the protein sequence

Length: 1105 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93078 0 100.0 myosin IXA vari...
 Homo sapiens
BAG06737 0 98.2 MYO9A variant p...
 Homo sapiens
EAW77880 0 98.2 myosin IXA, iso...
 Homo sapiens
NP_008832 0 98.2 myosin-IXa [Hom...
 Homo sapiens
EAW77879 0 98.2 myosin IXA, iso...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001609 244 274 PD000355 Myosin head
FPrintScan IPR001609 151 170 PR00193 Myosin head
IPR001609 207 232 PR00193 Myosin head
IPR001609 252 279 PR00193 Myosin head
IPR001609 488 516 PR00193 Myosin head
IPR001609 541 569 PR00193 Myosin head
HMMPfam IPR000159 3 87 PF00788 Ras-association
IPR001609 123 646 PF00063 Myosin head
IPR001609 839 960 PF00063 Myosin head
IPR000048 976 996 PF00612 IQ calmodulin-binding region
IPR000048 999 1019 PF00612 IQ calmodulin-binding region
IPR000048 1031 1051 PF00612 IQ calmodulin-binding region
IPR000048 1072 1092 PF00612 IQ calmodulin-binding region
HMMSmart IPR000159 1 87 SM00314 Ras-association
IPR001609 115 973 SM00242 Myosin head
IPR000048 974 996 SM00015 IQ calmodulin-binding region
IPR000048 997 1019 SM00015 IQ calmodulin-binding region
IPR000048 1029 1051 SM00015 IQ calmodulin-binding region
IPR000048 1070 1092 SM00015 IQ calmodulin-binding region
ProfileScan IPR000159 1 87 PS50200 Ras-association
IPR000048 998 1027 PS50096 IQ calmodulin-binding region
IPR000048 1030 1056 PS50096 IQ calmodulin-binding region
IPR000048 1071 1100 PS50096 IQ calmodulin-binding region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp