ORK07561

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07561

Order Kazusa clone(s) from :

Accession No	AB209996
Product ID	ORK07561
Clone name	ef02778
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
Symbol	CENPE
cDNA sequence	DNA sequence (8167 bp) Predicted protein sequence (2585 aa)
HaloTag ORF Clone	FHC07561
Flexi ORF Clone	FXC07561
Description

Features of the cloned cDNA sequence

Description

Length: 8167 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	409 bp
Genome contig ID	gi89161207r_104146419
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TACCTTACACATTCAATAAATGTTTAGTAGTTCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATCACCGCTCTTCTATATAATGTTAATGGTTTCTTGGTGAGGTAGTCTC

Features of the protein sequence

Description

Length: 2585 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06078	100.0	CENPE variant p...	Homo sapiens
XP_001170315	98.6	centromere prot...	Pan troglodytes
Q02224	95.4	Centromere-asso...	Homo sapiens
EAX06169	94.1	centromere prot...	Homo sapiens
EAX06170	94.0	centromere prot...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	662	879	PD317567	NULL
	NULL	1231	1426	PD125763	NULL
	NULL	1706	1783	PD042919	NULL
	NULL	1784	1951	PD013253	NULL
	NULL	1952	2006	PD042919	NULL
FPrintScan	IPR001752	82	103	PR00380	Kinesin
	IPR001752	199	216	PR00380	Kinesin
	IPR001752	235	253	PR00380	Kinesin
	IPR001752	286	307	PR00380	Kinesin
HMMPfam	IPR001752	17	335	PF00225	Kinesin
HMMSmart	IPR001752	9	342	SM00129	Kinesin
ProfileScan	IPR001752	8	265	PS50067	Kinesin
ScanRegExp	IPR001752	234	245	PS00411	Kinesin
ScanRegExp	IPR001412	2407	2417	PS00178	Aminoacyl-tRNA synthetase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp