Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07563
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209998
Product ID ORK07563
Clone name eg01013
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol UNC13B
cDNA sequence DNA sequence (6352 bp)
Predicted protein sequence (1620 aa)
Description
Features of the cloned cDNA sequence

Length: 6352 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1301 bp
Genome contig ID gi89161216f_35052006
PolyA signal sequence
(AATAAA,-18)		 
+----*----+----*----+----*----+----
ATTATAGGCTAGTCTGTAATAAATTATCTTATAGC
Flanking genome sequence
(343327 - 343376)		 
----+----*----+----*----+----*----+----*----+----*
AGCCTTTGGGGTTTGGTAATTCTGCTAATGTGTGGAAAGCCATGGAAATG

Features of the protein sequence

Length: 1620 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06080 0 100.0 UNC13B variant ...
 Homo sapiens
O14795 0 99.9 Protein unc-13 ...
 Homo sapiens
AAC19406 0 99.7 Munc13 [Homo sa...
 Homo sapiens
XP_001166329 0 99.4 UNC13 (C. elega...
 Pan troglodytes
CAH91201 0 98.9 hypothetical pr...
 Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002219 504 518 PR00008 Protein kinase C
IPR002219 520 529 PR00008 Protein kinase C
IPR002219 533 544 PR00008 Protein kinase C
IPR002219 545 557 PR00008 Protein kinase C
IPR000008 646 658 PR00360 C2 calcium-dependent membrane targeting
IPR000008 670 683 PR00360 C2 calcium-dependent membrane targeting
IPR000008 691 699 PR00360 C2 calcium-dependent membrane targeting
HMMPfam IPR000008 33 108 PF00168 C2 calcium-dependent membrane targeting
IPR002219 507 559 PF00130 Protein kinase C
IPR000008 631 722 PF00168 C2 calcium-dependent membrane targeting
IPR010439 946 1051 PF06292 Protein of unknown function DUF1041
IPR010439 1172 1262 PF06292 Protein of unknown function DUF1041
IPR000008 1469 1559 PF00168 C2 calcium-dependent membrane targeting
HMMSmart IPR000008 32 123 SM00239 C2 calcium-dependent membrane targeting
IPR002219 507 556 SM00109 Protein kinase C
IPR000008 630 737 SM00239 C2 calcium-dependent membrane targeting
IPR000008 1468 1574 SM00239 C2 calcium-dependent membrane targeting
ProfileScan IPR002219 506 556 PS50081 Protein kinase C
IPR000008 630 722 PS50004 C2 calcium-dependent membrane targeting
IPR014770 1042 1185 PS51258 Munc13 homology 1
IPR014772 1292 1434 PS51259 Munc13 homology 2
IPR000008 1468 1559 PS50004 C2 calcium-dependent membrane targeting
ScanRegExp IPR002219 507 556 PS00479 Protein kinase C
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp