ORK07567

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07567

Order Kazusa clone(s) from :

Accession No	AB290180
Product ID	ORK07567
Clone name	ff01553y2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone ff01553y2 has an irregular adapter sequence (GTCGACCCAC GCGTCCGTAA TACGACTCAC TATAGGGCGA ATTGGGTACC GGGCCCCCCC TCGAGGTCGA CCCACGCGTC CGTAATACGA CTCACTATAG GGCGAATTGG GTACCGGGCC CCCCCTCGAG GTCGACCCAC GCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	MYO5A
cDNA sequence	DNA sequence (11909 bp) Predicted protein sequence (1829 aa)
Description	Homo sapiens mRNA for MYO5A variant protein

Features of the cloned cDNA sequence

Description

Length: 11909 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	6419 bp
Genome contig ID	gi51511731r_50286775
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ATTATGGAAACTTGTTTAAATAAAGATATGGATAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGAGTTTTTGTCAGTGTCTTATAAGCAAATCCACTGCACATTTTAAAA

Features of the protein sequence

Description

Length: 1829 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAF80583	100.0	MYO5A variant p...	Homo sapiens
XP_001170426	99.8	myosin VA (heav...	Pan troglodytes
CAA69036	99.7	mysoin heavy ch...	Homo sapiens
EAW77450	99.8	myosin VA (heav...	Homo sapiens
XP_001170349	97.8	myosin VA (heav...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	194	224	PD000355	Myosin head
BlastProDom	IPR002710	1589	1732	PD003376	Dilute
FPrintScan	IPR001609	101	120	PR00193	Myosin head
	IPR001609	157	182	PR00193	Myosin head
	IPR001609	202	229	PR00193	Myosin head
	IPR001609	433	461	PR00193	Myosin head
	IPR001609	486	514	PR00193	Myosin head
HMMPfam	IPR001609	72	752	PF00063	Myosin head
	IPR000048	768	788	PF00612	IQ calmodulin-binding region
	IPR000048	791	811	PF00612	IQ calmodulin-binding region
	IPR000048	816	836	PF00612	IQ calmodulin-binding region
	IPR000048	839	859	PF00612	IQ calmodulin-binding region
	IPR000048	864	884	PF00612	IQ calmodulin-binding region
	IPR000048	887	907	PF00612	IQ calmodulin-binding region
	IPR002710	1661	1766	PF01843	Dilute
HMMSmart	IPR001609	64	765	SM00242	Myosin head
	IPR000048	766	788	SM00015	IQ calmodulin-binding region
	IPR000048	789	811	SM00015	IQ calmodulin-binding region
	IPR000048	814	836	SM00015	IQ calmodulin-binding region
	IPR000048	837	859	SM00015	IQ calmodulin-binding region
	IPR000048	862	884	SM00015	IQ calmodulin-binding region
	IPR000048	885	907	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	767	796	PS50096	IQ calmodulin-binding region
	IPR000048	790	819	PS50096	IQ calmodulin-binding region
	IPR000048	815	842	PS50096	IQ calmodulin-binding region
	IPR000048	838	867	PS50096	IQ calmodulin-binding region
	IPR000048	863	890	PS50096	IQ calmodulin-binding region
	IPR000048	886	915	PS50096	IQ calmodulin-binding region
	IPR002710	1508	1784	PS51126	Dilute

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp