ORK07569

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07569

Order Kazusa clone(s) from :

Accession No	AB209503
Product ID	ORK07569
Clone name	ff08583
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DGKQ
cDNA sequence	DNA sequence (4391 bp) Predicted protein sequence (885 aa)
Description	Homo sapiens mRNA for diacylglycerol kinase, theta variant protein.

Features of the cloned cDNA sequence

Description

Length: 4391 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1733 bp
Genome contig ID	gi89161207r_842676
PolyA signal sequence (AATACA,-25)	+--------+--------+----*----+---- ATCCAGGACAAATACAGTCTGGGCGTCACTATCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCATCTCTTCCTCATCTTTGTGTCAACAACCGAGGGGAGGGGAGGGCCT

Features of the protein sequence

Description

Length: 885 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92740	0	100.0	diacylglycerol ...	Homo sapiens
XP_545985	0	77.7	similar to diac...	Canis lupus fam...
EAW82630	6.9e-195	92.8	diacylglycerol ...	Homo sapiens
EAW82632	7.2e-195	98.3	diacylglycerol ...	Homo sapiens
NP_001338	7.2e-195	98.3	diacylglycerol ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001206	526	629	PD005043	Diacylglycerol kinase
BlastProDom	IPR000756	812	862	PD002939	Diacylglycerol kinase accessory region
FPrintScan	IPR002219	14	28	PR00008	Protein kinase C
	IPR002219	30	39	PR00008	Protein kinase C
	IPR002219	167	178	PR00008	Protein kinase C
	IPR002219	179	191	PR00008	Protein kinase C
HMMPfam	IPR002219	17	67	PF00130	Protein kinase C
	IPR011424	89	117	PF07649	C1-like
	IPR002219	140	193	PF00130	Protein kinase C
	IPR000159	252	300	PF00788	Ras-association
	IPR000159	351	450	PF00788	Ras-association
	IPR001206	531	658	PF00781	Diacylglycerol kinase
	IPR000756	684	836	PF00609	Diacylglycerol kinase accessory region
HMMSmart	IPR002219	17	64	SM00109	Protein kinase C
	IPR002219	78	124	SM00109	Protein kinase C
	IPR002219	138	190	SM00109	Protein kinase C
	IPR000159	351	450	SM00314	Ras-association
	IPR001206	531	658	SM00046	Diacylglycerol kinase
	IPR000756	684	836	SM00045	Diacylglycerol kinase accessory region
ProfileScan	IPR002219	16	64	PS50081	Protein kinase C
	IPR002219	77	124	PS50081	Protein kinase C
	IPR002219	139	190	PS50081	Protein kinase C
	IPR000159	351	450	PS50200	Ras-association
ScanRegExp	IPR002219	17	64	PS00479	Protein kinase C
	IPR002219	78	124	PS00479	Protein kinase C
	IPR002219	140	190	PS00479	Protein kinase C

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp