ORK07570

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07570

Order Kazusa clone(s) from :

Accession No	AB209505
Product ID	ORK07570
Clone name	ff09145
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MYO5A
cDNA sequence	DNA sequence (10770 bp) Predicted protein sequence (1409 aa)
Description	Homo sapiens mRNA for Myosin Va variant protein.

Features of the cloned cDNA sequence

Description

Length: 10770 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	6426 bp
Genome contig ID	gi51511731r_50286775
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ATTATGGAAACTTGTTTAAATAAAGATATGGATAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGAGTTTTTGTCAGTGTCTTATAAGCAAATCCACTGCACATTTTAAAA

Features of the protein sequence

Description

Length: 1409 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92724	100.0	Myosin Va varia...	Homo sapiens
BAF80583	99.7	MYO5A variant p...	Homo sapiens
XP_001170426	99.5	myosin VA (heav...	Pan troglodytes
CAA69036	99.5	mysoin heavy ch...	Homo sapiens
EAW77450	99.5	myosin VA (heav...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002710	1169	1312	PD003376	Dilute
FPrintScan	IPR001609	13	41	PR00193	Myosin head
FPrintScan	IPR001609	66	94	PR00193	Myosin head
HMMPfam	IPR001609	9	332	PF00063	Myosin head
	IPR000048	348	368	PF00612	IQ calmodulin-binding region
	IPR000048	371	391	PF00612	IQ calmodulin-binding region
	IPR000048	396	416	PF00612	IQ calmodulin-binding region
	IPR000048	419	439	PF00612	IQ calmodulin-binding region
	IPR000048	444	464	PF00612	IQ calmodulin-binding region
	IPR000048	467	487	PF00612	IQ calmodulin-binding region
	IPR002710	1241	1346	PF01843	Dilute
HMMSmart	IPR001609	2	345	SM00242	Myosin head
	IPR000048	346	368	SM00015	IQ calmodulin-binding region
	IPR000048	369	391	SM00015	IQ calmodulin-binding region
	IPR000048	394	416	SM00015	IQ calmodulin-binding region
	IPR000048	417	439	SM00015	IQ calmodulin-binding region
	IPR000048	442	464	SM00015	IQ calmodulin-binding region
	IPR000048	465	487	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	347	376	PS50096	IQ calmodulin-binding region
	IPR000048	370	399	PS50096	IQ calmodulin-binding region
	IPR000048	395	422	PS50096	IQ calmodulin-binding region
	IPR000048	418	447	PS50096	IQ calmodulin-binding region
	IPR000048	443	470	PS50096	IQ calmodulin-binding region
	IPR000048	466	495	PS50096	IQ calmodulin-binding region
	IPR002710	1088	1364	PS51126	Dilute

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp