ORK07573

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07573

Order Kazusa clone(s) from :

Accession No	AB209126
Product ID	ORK07573
Clone name	fg01250
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TONSL
cDNA sequence	DNA sequence (6601 bp) Predicted protein sequence (897 aa)
Description	I-kappa-B-related protein

Features of the cloned cDNA sequence

Description

Length: 6601 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2032 bp
Genome contig ID	gi51511724r_145525280
PolyA signal sequence (AATAAA,-8)	+--------+--------+----*----+---- TCCGTCTCAAAAAAAAAATAAAAATAAAATAAATG
Flanking genome sequence (99693 - 99644)	----+--------+--------+--------+--------+----* AAGCTGCTGCCTCCCTCCCCGTGGCTGCCTGGCAGGCGGGTGGGCGGGGT

Features of the protein sequence

Description

Length: 897 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92363	100.0	I-kappa-B-relat...	Homo sapiens
EAW82092	99.1	nuclear factor ...	Homo sapiens
Q96HA7	99.0	NF-kappa-B inhi...	Homo sapiens
AAH08782	98.9	Nuclear factor ...	Homo sapiens
XP_520018	97.7	I-kappa-B-relat...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	262	274	PR01415	Ankyrin
	IPR002110	274	286	PR01415	Ankyrin
	IPR001611	800	813	PR00019	Leucine-rich repeat
	IPR001611	828	841	PR00019	Leucine-rich repeat
HMMPfam	IPR002110	228	260	PF00023	Ankyrin
	IPR002110	261	293	PF00023	Ankyrin
	IPR002110	297	329	PF00023	Ankyrin
	IPR013101	830	857	PF07723	Leucine-rich repeat 2
HMMSmart	IPR002110	228	259	SM00248	Ankyrin
	IPR002110	261	290	SM00248	Ankyrin
	IPR002110	297	326	SM00248	Ankyrin
	IPR003590	769	796	SM00368	Leucine-rich repeat
	IPR003590	797	824	SM00368	Leucine-rich repeat
	IPR003590	828	855	SM00368	Leucine-rich repeat
ProfileScan	IPR002110	217	335	PS50297	Ankyrin
	IPR002110	228	260	PS50088	Ankyrin
	IPR002110	261	293	PS50088	Ankyrin
	IPR002110	297	329	PS50088	Ankyrin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp