Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07584
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209386
Product ID ORK07584
Clone name fh19857
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol RPS7
cDNA sequence DNA sequence (5429 bp)
Predicted protein sequence (78 aa)
Description Homo sapiens mRNA for ribosomal protein S7 variant protein.
Features of the cloned cDNA sequence

Length: 5429 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 601 bp
Genome contig ID gi89161199f_3500823
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CAAAAATGACTAAATAAAAAGTATATATTCACAGT
Flanking genome sequence
(105562 - 105611)
----+----*----+----*----+----*----+----*----+----*
ACTCTGTTTCAGTTATGTTTTTCAAAATTCCAAATTCACGGATGCGCAGC

Features of the protein sequence

Length: 78 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92623 1e-30 100.0 ribosomal prote...
Homo sapiens
AAK53430 2.3e-17 98.1 ribosomal prote...
Anopheles dirus
XP_855766 3.1e-17 76.8 similar to 40S ...
Canis lupus fam...
EDM03216 3.4e-17 76.8 rCG62292, isofo...
Rattus norvegicus
XP_001478257 3.4e-17 76.8 similar to ribo...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000554 37 61 PD006276 Ribosomal protein S7E
HMMPfam IPR000554 10 61 PF01251 Ribosomal protein S7E
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp