Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07594
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB290164
Product ID ORK07594
Clone name fj10308y2
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol DNAH5
cDNA sequence DNA sequence (7043 bp)
Predicted protein sequence (1972 aa)
Description Homo sapiens mRNA for DNAH5/KIAA1603 variant protein
Features of the cloned cDNA sequence

Length: 7043 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1123 bp
Genome contig ID gi51511721r_13643970
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AATTATAGTTGGCTTGAAAAAATGTGATGATCAGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGAAAAAATAAAAAAAGGGTAGAAATATTAGACGGTGCGTAGGGACTTTC

Features of the protein sequence

Length: 1972 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG06718 0 100.0 DNAH5 variant p...
Homo sapiens
EAX08050 0 100.0 dynein, axonema...
Homo sapiens
Q8TE73 0 99.8 Dynein heavy ch...
Homo sapiens
XP_001500013 0 95.0 similar to Dyne...
Equus caballus
XP_848572 0 93.7 similar to dyne...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004273 1275 1970 PF03028 Dynein heavy chain
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp