ORK07602

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07602

Order Kazusa clone(s) from :

Accession No	AK226103
Product ID	ORK07602
Clone name	fj17479
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TRMT1L
cDNA sequence	DNA sequence (4120 bp) Predicted protein sequence (728 aa)
Description	N2,N2-dimethylguanosine tRNA methyltransferase-like

Features of the cloned cDNA sequence

Description

Length: 4120 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1931 bp
Genome contig ID	gi89161185r_183253843
PolyA signal sequence (ATTAAA,-34)	+--------+--------+----*----+---- CATTAAAACTTGATAAACAAAAGAACGAGTTAAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACCAGTGTGTTGACTCTGCTAGTTGCTAATGTTAATACTCTAGCCATA

Features of the protein sequence

Description

Length: 728 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7Z2T5	100.0	TRM1-like protein.	Homo sapiens
BAG35660	99.8	unnamed protein...	Homo sapiens
BAC11302	99.8	unnamed protein...	Homo sapiens
XP_514058	99.4	N2,N2-dimethylg...	Pan troglodytes
Q5R5T0	98.6	TRM1-like protein.	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002905	235	684	PF02005	N2
HMMSmart	IPR015880	114	140	SM00355	Zinc finger
HMMSmart	IPR015880	179	201	SM00355	Zinc finger
ProfileScan	IPR007087	179	206	PS50157	Zinc finger
ScanRegExp	IPR007087	181	201	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	444	GIEVLFAVALEHFVLVVVRVLRG	466	PRIMARY	23