Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07611
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209276
Product ID ORK07611
Clone name fk03930
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MAN1B1
cDNA sequence DNA sequence (3483 bp)
Predicted protein sequence (185 aa)
Description Homo sapiens mRNA for alpha 1,2-mannosidase variant protein.
Features of the cloned cDNA sequence

Length: 3483 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 590 bp
Genome contig ID gi89161216f_139018979
PolyA signal sequence
(GATAAA,-20)
+----*----+----*----+----*----+----
GGTCTTTTCGGTGGAGATAAAAGTTGATTTGCTCT
Flanking genome sequence
(104477 - 104526)
----+----*----+----*----+----*----+----*----+----*
AACCGCGATGTCGCCTGTGTCTTTAGGGATCTCCATGACTGGAAAGTCTG

Features of the protein sequence

Length: 185 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92513 9.2e-85 100.0 alpha 1,2-manno...
Homo sapiens
BAC11060 7.9e-75 99.4 unnamed protein...
Homo sapiens
BAG54653 1.4e-74 99.4 unnamed protein...
Homo sapiens
EAW88346 1.5e-74 99.4 mannosidase, al...
Homo sapiens
1FO2 1.7e-74 99.4

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001382 81 105 PR00747 Glycoside hydrolase
IPR001382 144 164 PR00747 Glycoside hydrolase
HMMPfam IPR001382 17 181 PF01532 Glycoside hydrolase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp