Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07613
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209278
Product ID ORK07613
Clone name fk04076
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SEMA6B
cDNA sequence DNA sequence (3634 bp)
Predicted protein sequence (518 aa)
Description Homo sapiens mRNA for semaphorin 6B isoform 3 precursor variant protein.
Features of the cloned cDNA sequence

Length: 3634 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1007 bp
Genome contig ID gi42406306r_4393606
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GCCCCCTCCCCATCAATAAAACTCTGTTTACAACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCGGCCCCCATGACTCTGGCTCTGCTCTGCCTCCTGGGGGTGGCACGGG

Features of the protein sequence

Length: 518 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92515 1.4e-162 100.0 semaphorin 6B i...
Homo sapiens
BAB20669 8.5e-158 96.5 semaphorin Z [H...
Homo sapiens
Q9H3T3 8.5e-158 96.5 Semaphorin-6B; ...
Homo sapiens
XP_001139016 9.3e-157 95.8 semaphorin 6B i...
Pan troglodytes
EDL23720 3.8e-130 82.7 sema domain, tr...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001627 15 119 PF01403 Semaphorin/CD100 antigen
IPR002165 155 205 PF01437 Plexin
ProfileScan IPR001627 1 153 PS51004 Semaphorin/CD100 antigen
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp