Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07616
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209287
Product ID ORK07616
Clone name fk05937
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FN1
cDNA sequence DNA sequence (3726 bp)
Predicted protein sequence (1011 aa)
Description Homo sapiens mRNA for Fibronectin 1 variant protein.
Features of the cloned cDNA sequence

Length: 3726 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 689 bp
Genome contig ID gi89161199r_215833834
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GAAAGACAACTGTTTTAATAAAAGATTTACATTCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACAACTTGAAGTTCATCTATTTGATATAAGACACCTTCGGGGGAAATAAT

Features of the protein sequence

Length: 1011 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92524 0 100.0 Fibronectin 1 v...
Homo sapiens
BAG10962 0 99.9 fibronectin pre...
synthetic construct
BAD52437 0 99.9 fibronectin 1 [...
Homo sapiens
BAD93077 0 99.9 Fibronectin 1 v...
Homo sapiens
CAE45786 0 99.8 hypothetical pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR003962 27 36 PR00014 Fibronectin
IPR003962 128 138 PR00014 Fibronectin
IPR003962 152 170 PR00014 Fibronectin
IPR003962 354 368 PR00014 Fibronectin
IPR000083 880 891 PR00012 Fibronectin
IPR000083 901 909 PR00012 Fibronectin
HMMPfam IPR003961 13 93 PF00041 Fibronectin
IPR003961 104 183 PF00041 Fibronectin
IPR003961 194 276 PF00041 Fibronectin
IPR003961 288 367 PF00041 Fibronectin
IPR003961 378 457 PF00041 Fibronectin
IPR003961 470 548 PF00041 Fibronectin
IPR003961 559 638 PF00041 Fibronectin
IPR003961 729 806 PF00041 Fibronectin
IPR000083 831 870 PF00039 Fibronectin
IPR000083 876 913 PF00039 Fibronectin
IPR000083 920 955 PF00039 Fibronectin
HMMSmart IPR003961 13 93 SM00060 Fibronectin
IPR003961 104 183 SM00060 Fibronectin
IPR003961 194 273 SM00060 Fibronectin
IPR003961 288 367 SM00060 Fibronectin
IPR003961 378 457 SM00060 Fibronectin
IPR003961 470 549 SM00060 Fibronectin
IPR003961 559 640 SM00060 Fibronectin
IPR003961 730 806 SM00060 Fibronectin
IPR000083 831 875 SM00058 Fibronectin
IPR000083 876 918 SM00058 Fibronectin
IPR000083 920 960 SM00058 Fibronectin
ProfileScan IPR003961 12 102 PS50853 Fibronectin
IPR003961 103 192 PS50853 Fibronectin
IPR003961 193 282 PS50853 Fibronectin
IPR003961 287 376 PS50853 Fibronectin
IPR003961 379 466 PS50853 Fibronectin
IPR003961 469 557 PS50853 Fibronectin
IPR003961 558 647 PS50853 Fibronectin
IPR003961 729 815 PS50853 Fibronectin
IPR000083 829 873 PS51091 Fibronectin
IPR000083 874 916 PS51091 Fibronectin
IPR000083 918 958 PS51091 Fibronectin
ScanRegExp IPR002086 229 236 PS00687 Aldehyde dehydrogenase
IPR000083 831 870 PS01253 Fibronectin
IPR000083 876 913 PS01253 Fibronectin
IPR000083 920 955 PS01253 Fibronectin
IPR013032 944 955 PS00022 EGF-like region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp