Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07618
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209545
Product ID ORK07618
Clone name fk11845
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ATRX
cDNA sequence DNA sequence (3676 bp)
Predicted protein sequence (1224 aa)
Description Homo sapiens mRNA for transcriptional regulator ATRX isoform 1 variant protein.
Features of the cloned cDNA sequence

Length: 3676 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi89161218r_76641860
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GAAACCTCCATGAGTTTAAGCTCCGATGATTATAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGTAAATCGAATACTTTTTCGTGCCATCCTGTATTGACAAAGTTAAAA

Features of the protein sequence

Length: 1224 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92782 0 100.0 transcriptional...
Homo sapiens
BAC81110 0 100.0 ATRX [Homo sapi...
Homo sapiens
AAB49969 0 99.9 putative DNA de...
Homo sapiens
AAB40699 0 99.9 putative DNA de...
Homo sapiens
AAB40698 0 99.9 putative DNA de...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000330 860 1186 PF00176 SNF2-related
HMMSmart IPR014001 853 1073 SM00487 DEAD-like helicases
ProfileScan IPR014021 878 1065 PS51192 Helicase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp